Description :
From Genome Similarity Track
Location :
Scaffold_119:90- 5913
Transcript NameFunction/comments
Phymu_g4773hypothetical protein PHYSODRAFT_532021
Phymu_g4774conserved hypothetical protein
Phymu_g4775hypothetical protein PHYSODRAFT_566196

Sequence
5823 bases(100 bases per row)
gtaaatagtgagttaacggactcgtacttgttctttgtataagaacggcagttattgatactaactgatactctaTGAGTAAttgtcttcctctgacgtt
aaagctacggcagccccgctgcacaGGGGGGGAGGCAGGGacgtgtcgaggagaactctaactaatgcttggcttgattttgTGAGTTTGATTTCACCCC
CTTCCTAACACCTAAACACTGCCAAAACTTAAACCGAATTTACACAAAAATTAGCTTTGTTTTtccaaatccacacagaaaattgattctaaattctgtg
gtagcagcgtgttcctcTACTAAGTGTGTGACGCGCAATGTACCCATATGTGACTTACATAAAAGGTATCCATttgtgacacacacaagctgcaacattc
gtgtaacaccccgttacacAGTAATACTTGATACAAATCCGGAGCAGTCCGGATACGGACTTTGTTTCATTTCGCGGTTTAACCAGATCAGACTATTTAA
ACTCGTTTAAACAACAATTCAATGAGATATATCCGGTTTACATATCGGTATTGGCAAGCAGCGCAATTCATAGTGCAGCCTGCATGGCGGCGGAGTTGCC
AGGAAGAGGCGAGTCCTCAACCAGCAGCGCTGGTATTAGTAGTAATGCCAATCCGTTCGAAGCGCAGTCAAGTGACAGGAACCCCTTCCCTTCCTTTGAC
GCCGCTCTAGCTGATAACTCGGAGGAGACCGAACAACTGGACTCAGACTCGGCGCTGGACTGGAGCATCGACACGCTCGCAGAGCTCAAACCCGCGGTCT
TCTCGCCACTGCCGCAGCAGAAAGATGCCGTCAATACGTCAAACCCGCTCGGGACGAGCTCATTCTTTGAGGATGAGAAGCAGTACGAGGTGCTGCGGAC
GCCGCTACCGGCAACGCggacgtcgacagcaagcaggaacagcacgatTCTCGTGCTGACATCGTCACCATCACCAGTATCGGAGCTGCATCGACGCTGT
AGAGAGACGATAGCACATTGCGAAGCTCCTCTGCGGGAGCGGCAACGTAAAATGGACAAAATGCAAGCTGTGCTGCTTCCGCCGACGCCGAAGCGGTCGT
TGCTTCAGAGATCGAGTCTCCAGCGTGGAACACCTCCGTCTCGATCGAGTCCACCGCGACCTACTAAGAGAAACAGGCTCAGCACTACAGTCACGCCAAA
GCAGGAGTGGAAGTCGCCTGCTATGAGGCCGCCTATGTGGTCAGCGTCGCCTATTGCCGCAGTGGGCAGCAGACAACCGCTCTGTGCGACACCAGCCACA
CTGCATTTCGACGCCTTGACTCCGTCGCCGTTGGTTACGTCGCCGAGGAGCACGACACCGAAGCAGTGTTCGAAGCTGCGGCTGTCCTTCGGACTATCGC
CCATCACATTCCCATCCCCAGAACAAGTAGAGCAGAAGATTGAGGAAGAGGCGAGCGGCGAGGACAAGCCAAACAACGAGGACACTCTACCGctgagcag
ctcaacggaGGAGTCCGCTGCGAGTGAATCTGAGAAGACGAACAGCGATGATCAGCAAGCGTCGATTGAAAGTGGGGGCCGTCAAAACTCGTCATCATCC
CACGATGCGATGCGCACCCCTGCGAAGAAATCGATGATGCCGGCGCGGTCTTCAATCTCTCGGCGGCGGCAGCAAGCCTTTatggaggcgatggaggcaG
AGGCTCGCTGCAGTTCCAATAGATCGCCCAGAACGACCAAACCGTCGACTTCAgcgttgtcgctgttgcAAGAAGCGAAACGCTTGGGAATTTCAGATTC
GCAGGCACAATGGCAATACGCGCAGATCGTACGCCGAGACGACGTTCATGACTTTGCTTCGTGTTAATTACTATGTAGTAGAATAGCAAGACTGTAGAGT
AAATGCACAATAACTTAAAGTCTCATCCACCGGAGATGCTCAGTTGGCTTTGGGGCTGTTGGCGTGGCTGCGACGCGACACGAGTCGGCGTTGCACGCGG
AAGTCTCCGATCCAGTAGCCGTCCGACCGCAGAGCGTCCTCCACCCTCTCGGAGTTGGATCTGCTCGACGCCGCGAACGCGTCCTGCTTGGACGTGAACG
TCGCGCGTCTCGAACGCTCCTTGTGCTTCGAGCTGTTGGTCATTCCTGTATCCGCGCGCCGTCTCGGCACTCGgcgtttcttctccatcacgtcgGCATT
GCTGCCGCGCGAGACTTTGGCTTTAGAGCTTGTTCTGTTGGATCTACTGTCTCCAACTGCTGAGGAGGACCGGGGTCGTGTGGCCTGTCTTCTCTGGAGT
TCTCCGTCTGTAGTGTTGCTGCGGGTCCGCACGTCCATGAGGCTCTTGCTGTGTATAGAGGGAGATCTGGCTGGCGTCTTGTTGCCACCAGAACCTGCTC
CAATTTCACTGTCATCGTCTTCGGACTCAGTTTCGGACGGGGGCGCCGACACCTTTTTGACCTGAACATCTGGGGCCATCGGGGCCACAACGGCCGCCTC
GGGCACtcgttcctgttcctgcgtttcttcttcttcagcttcctctGGCTGTGGCTTCTCCTCAatcgtctgcagcgtcgtctggGGCACCCGTGAGCAC
GAGTAGAACCCCTTGGCGTAGCGTTGTCGTCGCGAGTCAACGAACCAACAGGCGAGCGCAATGGCGCCGACTGTCAGCGTGTAGCGCAGCgtcacgagct
gcacgagtAGCACAGCGAGGCGCACAATGGCGGCcgttagcagcagcagcagcgccacaagcGACACTCCGGCCACGCACATGAGCCGCACGCCCATTAA
TAACGTTACTCAACCTGCGCACAAACAGGGAAATAGCGAAATGAAAAACAGTTTGGGACTGAAATAGGGCTGGTGACGGGGATGTGGCGGTCGGTGGCGT
GAAAGGGGATGAGTAACATTGGCCCGGCTCTGCGAAAATCAAGGATCCACATTTTCGAGAACGAGACGTGCCTGTTGTTGCTCTTATTAATAGTGTAGCT
CTTTGCCAGCGATAACCGAGAGTCTGTTGTTGGTGAACAGCAAAAAAAACCGCCTGAGGGTGGTGCTGCCGATGCTTGCAGCGAATCTGATTTGGTTCAA
CTCGCGTGCTTTGCGGCTTGATTTTCTTCGCCCACCACTTGTCGAGCACCTACGTTCCCGTCCCAATCTGAAGGCGGAGTTAACGATCGCGCAGAGGCGA
TCCCGGAAAACGTGGGTGGAATCGGTGCCGAGACATTTCAGAACAAGGGAAcaaccaagcagcagacggcggTGGCAGCGTCCATTTGAGGCGCGACCAT
GCACGGAAACTTCGGCAAATTTATCGGTGAAAGGTGTTGATCGGCGGTGCTCAGCGCTGCGCAGCACCGACGCGAAGCCACCTCCAATGGCCAGCGCTGT
GTCCACTGGACTTGGATTCCAAGTCAACAGAGATGGCGGTGGGAAGGGCCGGCTGCCGCCACTCCCTTCTCTGCATTGAAGTGACAAAGACTGTCGGGGG
CCCGGTCTTGGCCAGAGACCGCAAGACCGACCAGCTCGCTCGGCCTTGATGGCCAATCTCAACCTTAAATTATCAAGGTAAGATTCTCACCTTAGTCTGA
GCGAAACGGTGGGGGTTGCCGCACTGCCACCGCAGAAGCGCCCTATACTCGTGGTGCCAGTTGATCGTCTGTGTGGCGCTGTTTTCTAACAGGAAAAAGA
GCAACTCGAAAAGTTTGCGATACATTACCAGCGACGTGAATGGGGGAATCGGAAGAAGGACATGCACCGCCACGCTGACAGCAAATGCGCTCGTCAGCGA
CACGAAACATCCTGGCGTGCCCAGACTTCAACCAACAGAAAAACCGGCGGCTCGCAGTTAACGCGTTTCGAGCAAGCTCCTAACGCATCAAGCGACTTGC
TGCAGAACTTCCAAGTGGCCCGCCCTCCGCACGCTCTTTTGCGCTGACATCTTTTGTCTTGAGCGCACAACTCCTTTTTCTGCAGCCAGCTGCGaagcca
agctgctgccactaAACGCCAAATGACCCCGCGAAACAAATACACATTAGTTTTCGAAGACGGATCTTCGGTGGTCGCAGTATCCACCTTTTTGAAGCGA
ACGATGATGCTCGCCTTGCTGCTCTCCGCACTGCTCTTGGCGCGTGTACAGGGATCAGAGGACGGTGCCGAGCAGTCCACCGACAtcgtcaagctgcagc
gcgatgagcagctggaggcgccgctacaggagcttctgctggccCCGCTAGATGGCGACTGGGCGATGGATCTGGATGCGCGACTGCAACGCGCCTTCGT
GCAGTGTCGCGAGCTAGGCGTGACCTCGTTCATGTACGAGACGGCCAGCGATAGCAGTTCAGGTGTCTGGATGCAACTGGATGCGGACGACGTGGCCTAC
TGCAACCGTCTGCGCTACGTGCGGCACCAACGTCAGCACGTCCGCAACGTGCAGAAAACTCAGCAGGAGAACTACAACCGAGAAGTGGAGACCAGAACAG
CGGACGACGTTACTTTCCaggagttcttcgagctgtaCGCTGCGAATTCGAAgccagtgctgctgcacctgaaGGAGGACGAAAAGGACTCAGTGGCTCA
GTTACTCGGTCTCGAAAGCAGCGACAatgcagaggaagatgcCAGTAACAAAATGGACGAGTTTCTGAGTGTTTGCTTCGGTGAGGAAGCAAAGAGACGG
AAGGGTGATAGTCAAATCAAGTGGAGGCCGATGCGTGTTGAACACGACGACTGTGCGGCGATGCTGGAATCAACTTTTCGTGTACCGATTTACATGGCAC
ACGACTACGTGCAGCGTACCAACGCGTCCCGAGTTGAAGCGTTTGTGCCGGCAATTGTCGAGTTACCTTCGGTTACTGGCGATGCACTTCACAACGTGAA
GGAAATCGTGGCGTGTCCGTACGGACTCCACATGCTCGCTATCCCCCTCGAAGAGACTACCGTCTCGATGTTCGACCGAAAGTTCGAGCCGATAGCTCTT
CCTGTCGATCAGTTGCGAGAGGTTGCGCTCGGTGCTGACGCCAACGTAGCGACTGGATCTACAGTGTTAGACACGGAATATTTCCAGCGAGTGTCGGAGC
TGTACACTTCAGTGGAGTTGAAGCCCGGTCGCGACATACTCTTCGTTCCAGGGAACGTCATCTCGACAATGCGGTCGCTGACCACATCGCCGGCAAAACT
ACTACGCTTCTGCTACTGCGACGCCGCCAACGTCAAGGATGTCAAGCAAACGGCCAGCTTAGATGCGCTCCTCATGACACGCGACAGTAAGGACGAAGGT
CTGTATGCTTTACTCTATGCACTTCAAACGCCAGGCTTTGACTCCACCTTTTCACGTCGCCCGACTGCTGCTGATACAAGCTGGAGCACCTTCGTCAAGT
GGCCTCGTGAACCTGCCTACctgaccaagaagaaccgacgACATAAAgacgaccaagaaggagaagacgagcaacTATCGCGACGCGAACGGCTCAAGCA
GTGGCAAGATGACAAAAGGTGGGAAAGGTACATCGCGGCACTTACGTTGCCGGTGGCGTGGCCGCCTATTGTGGTTAACACGACTCGATCGACGGCCACA
TTGCGATGGCAGGAGCTTTACCAGCCTCTGAAACACGACCTGACCAGCTACGGCTATGAAGTGAGCTGGAAGCGCGAGGATCAAGAGAAAAATACAACAG
AAGCGAAAGAAGTGGCGGAGAATGCGGTAAATGTGACGTACGACCAGCTCACGCGCAGCAGAATGCCTTCAGCGCTTTTCGGGGACGACTTTGACGGCCG
GGACCTCGAGGCTGTGATCACCG