Description :
From Genome Similarity Track
Location :
Scaffold_1320:90- 5256
Transcript NameFunction/comments
g16196.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci
g16197.t1RAW24820.1 Retrovirus-related Pol polyprotein from transposon TNT 1-94 [Phytophthora cactorum
g16198.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
5166 bases(100 bases per row)
ACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAACCC
CCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGA
ACATTGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAAGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCC
AAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGATTTTAGCCTTCGGCAGGCTAAACGGCATGTGAACGCCCCACGGCTAATGCCACGACCG
GTGGTAAGGCCGTCGGGAGGTCTCGAACCAATGAACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCC
GCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAAGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAA
AAAACTAGAGGGACCAGCAGGGCGCCCCGCGCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAG
AGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTG
GAGCATCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAAGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGG
GGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACAATAAG
TTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGTGCTTCAGGAGCAGCAGCAGCGCGA
CAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCGCGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAA
GCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAAATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGC
GACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGGTGTAAAGAAGACGCGTCGGCTTTGGGAGCCG
ACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCATGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGC
CGGGCTTGAACGCGTGCGCCCGCGGGGAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGG
CTCCGCACGAGAAGTGAACGGCGCAAGCAAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAACAGTGTCTGCCGGGCAGACACAGGAGT
TGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACAAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAACCCTCCGACGTTAGCGTCGGA
GTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATG
ACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGTGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACT
CACTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCA
CGAGATTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGACAGTGGCCAGCAAGTCAAGGCAATCGACGTCTTCTTTGAAAGTCGTCGCAAGGCAGG
GCAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCCACGTTCTGTGTGAAGAAACAACAGGGCGGGCGGCGCATCGTTCATGCGTATAACAAGCTGAAC
GATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATTATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACG
GGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTTGTGATGCCGCAGGGGCT
GAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGTTATTTCGATGATGTGTTCATTCACAGC
CGGGCTGTGAACGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGA
AGTGTATCTTCGGGTCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATG
GCCTACGCCTTCAAATGTAAAGAAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTG
TCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATAGTCAGCAGGCCTTCGAAGCGGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGG
CGGTGGCCGACCAAGATCGCCCATTTCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCG
TGTGGTTTACTACCAATCGCGCCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTT
CGAGTGTATTTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCAC
GGTGGCTGTCATTCTTTGCTGAATATAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGC
GGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGATGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACAGGATGCG
GATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACAACTTCGTGCCCGTGTACACCGTTATCGTGTAC
ACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGCCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACCA
CGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAATACAAGTGGGTACGCAAGTAC
GTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTTGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTT
CAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGT
ACCAGCTGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGCATGCCACTCGACATCGTGTCGGATCGGGATCCG
CGCTTTACAGCACGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTTGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGC
GTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTCCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTC
GGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGG
GGAGGGTATCCGGTTAATTTAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCG
TCGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCACAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCA
GGGGTTCAGCTTGGATGCAATGGACTTTGTCCAGCGCCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTG
AATCCCAATAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAGCATGCAGTTTCCGATT
TCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCCT
GCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAACACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCT
TCGAGACGCCGGAGAGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACG
CAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAAACTCAAAGTTTGGTTG