Description :
From Genome Similarity Track
Location :
Scaffold_2864:90- 2723
Sequence
2633 bases(100 bases per row)
CCAATGGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGTGGGGATCTACACGCCGAGGATCTCGGGGATGGCCTGGCGGTAATCC
CGGAGGTACCACTGACCACAGAGGAGGTCACTATTGACGATATCCAAGTAGATCCAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCAGAAAAT
CTGGGAAAACCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATC
GCTCAAAGGGTGCGAAAGGTGGCACCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACATCCC
CGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGCCTGACTCGATTGATGGT
GTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTTGGTAGTTTAAAAC
GAAGCAGTAAAACCTAAAAAAAATAGAGAAAGAGTTCGGCGCAAAAACGCTCCTTTCTCCCATTCCTTTGGGAATGGTCCCAGAGGGGGAAAAGGCGGAG
GCTCTTGTTTTTTAAAAAAACCCCCCCCAATTTTTTACGCAAGGGAAGGAAAAAAGCTCCTCCCGGGGTTTTTCCGGAAAAACGCAAACCCAAAAAGGGG
AATCGGGAAAATGTAGGAATGGATCCTCAAGCGGAGAGCCAGGGGATCTGGGACCCGTCTGTGTTAAAACGCAGATCTTATATCGACGACATCTAATCCC
GGCGAAATCGTGGGATCAGCTGTGCGAAAGAGTGACATCCTACTGGAGGCGTGTACTAAGTGAAATCTCTCTATCAGCGTGGTGAAGAGCTATTGGGGGA
TGCGCAAGGTGGATACTTAGTCATCGAGTCTCCAAGGAGGGACTGAGGCGAATCCTAAGGACCTGTCTTCGTTGAGAGACTTGTTCTTCCACAGTCGTTA
CGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGCGGTACTCTATGAATTATAGGGGGTGG
ATTTTGCTGCGATGACCACTTCGGCTGTCCGGATCAAAATCTAACAAGCTCTGGCCCTAGAGATCGCGGATCCACGAAGGGATCCAAGTAGTACGACGCC
GGAAGACGACCTAAAACAGGAACTGGATCCACCCCGGGACCAACGGAAAGAGGATCCAATCTGGATAGAGACGACGGCGGAGAACACGGAAAAGGTGGAG
CCTCGGTGGATCCGAGCTCGGCACGCGTTCGTGGAGCTAAGGAACAGGATCGCGACGACGCCCATCCTCCGCCATTTCGATCCGGAACGTCAACCTACGG
TGATAGTTTATGCTAGTGACTGGGCAGTATCAGCAGCCCTGGTACAAGAACATGAGGGGATCTGCCATCCAGTCATCTTCGTCAGCCGGACGCTAAAGCC
GAATGAGCTGAATTACGGAGCGGTGGAGAAGGAGATGCTCGCGCTCCTGCGGGTGTTGGATCCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGATA
CTCTACGCTAGCTTGGTTGCTCAAGTCGGCCGGTTTACAAGGACGGTTGGGACAGCGGGCAGCTTTGCTCTTACCTTGGACACTGGAGATCGTGAAATGT
TCGAAAGGGGAAGACGAGATCCTGGGAGGTTTGGCCGCGAGCATCACACCCAGAGCCAAGATGGACGAAGCGCTGACTAGGATCGCTCCTAAGAAAGAGC
CCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAAGTGGATGAGAATTTGTACGTTCTGAGTTTCGATGGATCTGCTCGCGTGCAACGTGGTGGAGG
AGCATACAGCGCAATACTGTGGAAACTGCCCGGATGGGAAGTGGTAAGGGGCCAGATCCACTTACGCGGAAGGGCCTCACCGTCAATGAAGCGGAGTATA
GCGGACTCCTGCTGGGTTTGGAGTTACTAAATGAAGAGGATCCGAAAAGGCGGGTGATATGTGGAGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGA
GATTGACTGCAAGGCCCCGGCACTAACGCTGCTACGGCAGAAGGTGATGATCCATCTGCGTGGTTGGATGAATTACGAGCTAGTACATGTCAAGCGAGAT
TGGAATGCCAGTGCGGACAGTTTGGCCAGTGCCGCCTTACGAAATCAATGTGATGCTGAGGTGGAGAGAGAGGCCGAGCGTCAGGATCTCGTCACGTTAA
ACCGACTAGACGAAGTGGTGGTGGTTGGATCTGAAGCGGACGGTCCAGGTAATGGCTGTCACTAGATCCAGAGGAAGGATTGGATCCAGCCCCCAGATTC
TCGATGAAGCATTTTTGAAGGGAGTCCGTATTGAGCGGATTCTCAAAGCACAGAACGAAGAAGTGTGGATCCTGGGACTAAAGAAGTATCTGATGGGGGA
TGTACGAGACCTGAGTCGGGAAGATGCCAAATC