Description :
From Genome Similarity Track
Location :
Scaffold_2952:90- 2712
Sequence
2622 bases(100 bases per row)
GACATCGGATGTGCGGGGACGCGAAACTCCAATCGCTCAAAAGGCGTCCGGTACGGTCGCACCTCAGTTCCGCGAAAAACTGGTCCGGATCTGATTAAGG
GCCTGCCTGCAATCCAGGGATCATCAGCTTTCTCAACGTCCCCGTTGGGCGTCGCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGT
GCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTGATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTA
CTGCTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGG
ACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGG
GTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGAGATCCTGGGACCCCGTCTGTGTTAGGAAGCAAACTTTACTTAAA
TCTCACGAATCTCTGGAACTCGCGGGGAAATCCGGGGAATCTGTTTGTGTGAAAAGAGTGACATCCCTACTGGAGGCGTGGTACTAAGATGGAATCTCTC
TATACAGTGGTGTTAAGAGCTATTGGGGGATGCGCAAAGGTGGATTACTTGGGCCATCGAGTTTCCAAGGAGGGATTAGAGGCGAATCCTAAGGACCTGT
CTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTGGGCAGTTTGAAACTACTACAGTCGGTTCATCGAAGATTACGCCC
TGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTCCAGCTGTCCGGATGAAAATCCAACAAGCTCTGGCCCGGGAGAT
GTCGGATCCACGAAGGGATCCAAGTGGTATGAGTCAGAAGAGGACCTAACACAGGAGCTGGATTCCACTCCGAGAACCAACAGAGAGAGGATCCAGTCTG
GGATAGAGACGACGGAATCAGAACTTGGAAAAGGGCGAATTCTGCGTAGGATTCGAGGCTCCAACACGCATTTCTTGGAACTGAGGAAACAGAATTTGCG
CCACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTGCAAGAACA
TGAAGGGATCTGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTTGCGCTCCTGCGC
GTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGACCCATCCGGATCCTGACTCGACACTCCACGCTAGCTTGGCTGTTCAAGTCGGCCGGGTTGCAAG
GACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCGTGGACGCTGGAGATTGTGAAGTGCTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAG
CATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTG
GATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGGGGAGCATACAGTGCAGTACTGTGGAGACTGCCCGGATGGGAGG
TTGTACGGGACAGATCCACTTACGCGGAAGGCCTCACCATCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCC
AAAAAGGTTGGAGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTTACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAA
GTGATGATCCACCTGCGTGGTTGGATGAATCACGATTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGTG
ATCAATGTGGTGTCGAAGTGGATAGAGAGGCCGAGCGTCAGGATCTCGTTACATTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGAC
AGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGGTTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGATC
CTCAAAGCACAAAACGAGGAAGCGTGGATCTTGGGACTGAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATCCTACAGTA
TTATCGCTACGGATTACGCAGTGGATCTGAATGCCTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGACCGGGATGGATTGATGAGACTGGT
GATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCATGCTAGCCTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAA
TGTTTCGCACTGGAGAGGACTA