Description :
From Genome Similarity Track
Location :
Scaffold_3117:90- 2575
Sequence
2485 bases(100 bases per row)
CAGCGAGACAGACTCGGCGGTAATCTTCTGGGTCAGAGTCCGAACCGTCGGATCCCGACTCAGTTCCTGAGTCGGGCGCTGTGACTTGGTGGACACGACG
AGCTGGAGCCGTGGGCGTCGAAGATTTTTGGCGATACTTGCCGGATCCGACCGCCGTCTTCTTCTGGCGGTGCTTCGCGCGATCCACAGCCCGCAGCACT
TCTTCAAGCTCATCTGCGTCTTGAAGGCGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAGCGTCTTGATGAAATGAGCAACATGTTCCCGTA
GTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGCCGATGAAGATATTCCAGCGGGGATTCGTCCGATCTGCGGCG
AGCATGGTAGTATTGTCGCGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCT
AGCTGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGA
CTTTGCTGATCCATGTCCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGA
CGATCCCCCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCTC
TCCACTGACTCCATCTCCACGGCTCGTGCTCCATGTTCGTGAAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGGAAACGACTCA
TCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGTTCCACTGGCGAGACAGGATCCGTGAGGCGGTTACC
TTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGGTCCTGA
GCCTTCGCGTTCACAGGGGCTTCCTGTCCTCGGATCATCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACG
ACGTATCTGACTCATCCCCAGCGGCGGATTCGTATTTCGAGGACGCAGCTTGGCTGATCCTCGGTGACGACACTGGATCCATAGTACGCGACCTTTCTCC
GGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCTTCTGCGTCGAACACACCAGCTACG
ATGCCTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCT
GTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGA
CCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCATCTTTCTTGTTTCTTCGACTAGCGGG
CTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAGTCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGT
CAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCT
CCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGA
GCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCC
AGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTA
GTCGAGATCTGCTCTCTCAGTAACTTCCGAAAAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGAGGTGGAGCACCAGTGGAAAATC
TTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTATGGTTGCCTTGCGG
GTGTGTTCTCTTGCCTTTGTGGTTCCTTAGCGTCGTACTTGCCGCATCCTGTGACGGGATCTTGAGAGTTGAAAAACTGAAGGGT