Description :
From Genome Similarity Track
Location :
Scaffold_1332:9- 5068
Transcript NameFunction/comments
g17840.t1hypothetical protein
g17841.t1hypothetical protein
g17842.t1ETI33998.1 hypothetical protein F443_19400, partial [Phytophthora parasitica P1569

Sequence
5059 bases(100 bases per row)
TGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGTAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTTATGGTGTCAACTAACACGCGGT
TGGCACGCTCTGTTTGTCCGTCGGTCTGCGGATGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGT
AAAGCGCGGATCCTGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCCGTCTGTTTGGCTGTCAC
CTCGGCTGGTACTGCAGCAAGATGGTGCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACA
AAGTCCATTGAAATGGACTGCCAGCACTCCGAAGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGC
AAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGGCTCCAGTAGAAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGT
CGGGGCATCGTGGTATTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCTGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGC
AGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTTAGAAGGTGTGGAGAAGTACTCCAACAATT
GCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACGCAGTTGGCGTCGGC
CTCTTGCGCCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAAT
GACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAAACCACGAATGGTCTACTCCCAAGTA
GATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTA
CGATCACGACCTTCGTAATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCG
CCCAGATCGGCGCCTCAGTCAAGCCCAGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGA
CAGCGGGCGAACCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGC
CATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGTATCTCGGTCGCCCCGAAGATACACTT
CTTCAGGTTCGCGTAGTGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGG
CTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGGGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCA
GCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCC
GTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTTATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCG
TTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTTGATTCCCGCACTTGTC
CTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACACAGTACTTCGTTCCCGGCACGAG
ATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAGGACCTTGTAAAAGGGGCTC
GCTTTGAGCGAGTCCCAGCTTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTTCT
GCTGCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGA
GCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCGGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGAC
GGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACAGAGACTTGCGCAGCTTTGATCGCTTACGCCGTTCACTT
CTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTATCCGCGGGCGCACGC
GTTCAAGCCCAGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATCTCCGGTGCGGGACGTTTGCAACCGTCCGCACT
GCTTGCAGCGTCGGCTCTGGGAGCCGACGCGTCTTTTTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTGCCTGT
CGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGGTTCGATTCACATCTTCTCCCAACGACTCTCGCA
GTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCGTTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGCGGTGCATGTGCTGCGCCGACAG
GGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCC
CAACACCATATCGAACTTATCGTCCATTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTATGATACGCTTCTCG
GTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACTTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAATAA
AGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGTTTCGGCTTGTCATCTTGCTTCTT
GCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGTTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCT
GGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTTCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACC
GATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGAGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCC
GACGGTCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAG
CCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACGGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGG
GTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGTCCTCGATCGG
AACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCC
AACTCCTCGCTCGTCCGCCAAGACATGACATGACGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAG
CCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGA
GCAGCGATTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCC
CAATGACTGTTAACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACATGTTTGGGCTACC
CACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATATGAACGTGTTCTTAGTCGGTCGTTGGACGGACTACAAAGTGCTAC
CAAGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAGTTTACTTAAGTTCAGTATACTTG
TATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACT
GATATTTCTAATGAGAGGTTTTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAAT