Description :
From Genome Similarity Track
Location :
Scaffold_1938:9- 4700
Transcript NameFunction/comments
Phypl_g14423hypothetical protein

Sequence
4691 bases(100 bases per row)
TCCCGCCAAGAGGAGGCGGCAAGTACGGAAAGGAACAAGAACACCCAAGGACAACCCCCCGTCGATCAAGCTTCATTCAAGATCAAGATTGACCCTACGA
CGGCCAagtgaagatttccacgcggCTGTCACCAACAATCCCCCAAGTACCGTCCATACCAGCCCAACACAAGATCGcaccgacgtcttcgccgtcaccg
gaAGAGCGAAACCCGCCCAACCAACGGGTACATAGGGTGAGAAGACTTCAACCCCCACGGACAAgcggagtaccccctccgtaaGTTGGTAGTCCGGGCG
ACCGTTGGCAAGCTTGGATCGCGTCAGCAATTTCGCGGtacctgctccgccacaatggtgcgcgtgcccggatcTTCTGGTGACTCTGGATTTCACCGTG
AGTCCACTGAAGAAGATGTCAAGATCAAGGTTGAGCCAGGGATTGGTGCGTCGACGGAAGGTGaatcgccgtcgtcgctggtgaaGTGCGAAGGATACAC
CGATCGTCAGAGCCCCCAGCTTCCTTCAGCTTGCGCATCAGGAGCttcaccgcgtccagcttgttgAGCACTTCCCTGGGCGCGGTTACGGGTCCTCGAA
GATCACCGATCAACTTCAGCCGCATGATCTTCAGAACTGGATccttgaccagcagcacgtacagTCCCTTTCGGTAGAAGACTGCTTCAAGCTGATCGTC
GGTCCAGTCCTCAAGCGCACTGCGATCTTCGGGGTCGGACTCCGGAGCCTTCAGCTTCATGCGCGGGGTCTTCTTCAAGGTCGCGCGCGAGGCTGGAGGA
GTGGTGTTAGATGAAGATCCCTCGGTTTTCACCGATGGATCTCCATCGTGCGGATTGCGAATATTCTCGCGACCCGCGGGGTCCCCGAAGGGACCTGggg
aggagatggaggcttCTCCTCTAGGTCCAACGCTGAACCTTCCTCCTTTtgcgtcgtcggagctcctCCCAGGCCTCCAGGCACAAGCGCGACCATGATG
AGGACCCAGACGATCTGTTTGATCTGGGCAATGGCGCACCGGGAGCTGCGGCCGCGATTtcagccacgacggccgacgcGGGTATCTCTCGCGTCCGTCT
CTCGGTCTTCTCGGAGTTGAAGGAGTTCCACGGACGAGACGCCAGCGAGGAGAAATCCAGAGCATGGCTAAATCGAGTGAAGTCAGCGTCGCACCGTGAC
GGTATGACCGGGAGCGAAGTCTGTGCCTCGTTCGGAGACCTGATGGTTGGACCCGCCCGCCAATGGTATCTGcagctgaccaagaaggtCCGGAAATCAT
GGCCGGACTTGATGGATCAATTCCGTGTCCAGTACTGCGGCAAAGGCGTGTCTATGGCGAGTCGCTACTATCACGCGGCCAAGCACCCGGTCGAAACAAC
CCCTGGATTATCTATATCGACTGAATGTCGCCGGCATGGGGGCGAAGATCCACTACTTGGACGGCACGACTGAAGAGAAGAGGGAACACGTGGAGTTATT
CATCAACACCCTGGGTccccaagagcaagagctggCATCGCGACTCACCTTGATGGAAGTACCGGACACCCTCACGCTGGAGAAAAAACGGCGCGCCAGA
CAACGTGGGCTGTCGCATCAGAAGAAAACTTTATTCGGGTCGAACAAGTTCAGGCAGAAggtgccagctccaccgcaGCCGGCCCGCGCAGTGCAAGCGA
TCCAAGCCACGCCAGATGGGTATGACTCGGGACGCGAGAGCCGATCTAGTGACGATCCGATCTGTGACCAAGATCGGGATGACGAGGAACGAGCGAGATT
GTTCGTAGCAGGTCAGACGCCGCCGGGAGAAATCGTCCGACGCGATCCGGGTCAGGAAAACCCGGGACGGGATCGCCCCTGATGCCGCCACTGCGGTTCG
CGACGCCATTCCGATGACGGTTGTTGGAGTCTCCTGACGTGCCAGAAATGTAATGGTCTCCACCCCACCGACCGATGTCTGCGGGCTTGCAAAGCTTGCG
GAGACGTGCATGAAGCGGGAGAGTGTCCCTTGGAAGAGTTCTTCAACCAGCTACGCCAGTGGTATAACCCACAGAAACACGCGgggatgctgccgccgac
ggcCGAAAAGATGTTAAACTAGATCGCTCGCTGGGTTGGAATCCAGTACGAGACGAGCGATCTGTTTTCGTCTATGCATatgtggccaagaagccgacAG
AGGTGGTTAGTGAgagatcgacgacttcgaagGGTAATACATGTGAATCGAATCCGCCACGTACGGTGCAAGATCGCGTTGCCCAAGTCTTGGCTATCCG
GCACGAAGACGATTACGCGAGAGAGCCGCCACTGGATGTGATCAACCTGCAGCCCGGCGAACGTCGTGGCTATTGGAAGTACTACGCGCCAGACAAGTGT
CATCGTCAGGCGAAGATTCAAGGAAAGTTGAACAACCGTCGTgcggtgttgctgctcgatgcAGGTGCCGAAGTGTCCATACTGGACGCTACCTTTGCTC
GTGAGGTAGGCTGCATGATCGACACGAACGTGACACAAGACTGCGTTGGAATCCCAGATGAGACGTATCACACGGTGGGGAGAACGAAGATCAAGGTTAC
TATGGCGGGTAACTTGATCTACTTCCTGGATCTCTGGGTCGGAGACTtggtcggccagcacgcgaTTTTGGGGATGAATTTCATGGTACCGGCCGGAGTG
CGCATCGACGCCGCGGACGGCACCGCCTGTTTACCCGACGAAGAGCGTATCCAGCTCACCGGGAGGCGACCGCTCTACGGTGCGAAGATGTGCCCGATCA
ACCTTACGTCGCTCGTGAAGATCGACCCGGGACAGACGCACGATGTTCGCCTCCGCCCGGACCGAAGCGCGCCGCAGCTGTGAGCCACAAGAGGTAAAAC
GtggtcagcagcttcgtgaaAGGCAAGATCGGGAGACGAACGTACCTACGCGTGACCAACGTCGGCAACGAAGCGATCACACTCGACGCCCACACGACGT
TGGGCTGGTGGACGCCCGTGAACCTCCTACTGCGCGCTTTTTGCTTCGTCCAGCTGGAGTCTCGACGCTACCGAGAGTGGCAGAACCTGGCTTACTGCGC
CACTTGCAGCGCCAATGAAGACGGGACGAATGCCGAACCTGAGCCAGAAAGACCAATGACCGAACGCTCGGTATATGAGATCCCGCAAGGGATCATGCGC
CGTGGCGAGGAGAGGCTGGCGAagcgagatgaaggcgcacGGATTGCAACTCCAGTGATGGcagcggtggcagcggcttcgCAGGATAAGAAGATGGCTG
CACGGCCAACGCACACATTCAAGACCGAAGAACCAGTCAGCCAGCCGTGGAAGGTCGGGAAAGTGGTATCGCCAGGAGACTTCGAAGGATCTCAGCTGGG
AGACGCCCCAAATCTGGAGAGATCTCAGCCGGGAGCCGAATGGTCGCCGCCGGAAGAGTCGCCGCCCGTAACCGTCGAAGGATCGCAACCGCCAGCTGGA
GGGCCTCCTCCGGGGAATACGGAAGGATCGCGTCCCCTGAACCAGGAGCTGACGAACGAAActgacgcggacgacgcgggcCTCATTCACGAAGGATCGG
ACCTCTTCGCGGAAAAAACTGGAAGCAGAGCTGGCGGTGTTGCCAGAGATCTCGCTGACGGCAGAAGTGCGGATCGGGGATCTAAAGGTGGGAAGGCCGA
CCGGGAACACACCCGAGGATGCcgcacagcaagaagagcgcctACGACAGGTTATCTGGAGGCGACGAAAATGGCTTATCGGGAAAGGCAATGCTTTGCC
GCCCGCGGCCGTGGGAGTCGTCTGCGATATAGATGTGGGCGACGCGAAGCCCATAGCACAACGCGTCCGCAAGATCCCGCCCCGCTTTAAGAAAAAGGTA
TCTGACTTGCTCAAGGGCTTGCTCAGTGCTGTCATGATCAGActgtccacgtcgccgtggGCGTCACCGATTGACGTGATCGTAAAGAAGAACGGGGTCG
ACATACGACTCTGCATCGACTACCGACTGGTGAACAGGCTGACGCAACTGGTGGTTTACCCGATGCCGCTCGTGAGCGACTTACTGGAGGACCTGGACAA
GTACCTGTGCTACTGTTCTCTTGACATGGCTAGCGGATTCTGGGTCGTCCCCATGACGGCTCGATCCCAGCTCATCTCCGCATTCGTTACCCCGTTCGGC
CTTTTGGAGTGGCTGCGCATGCCATTTGGCCTGTGCAACGCGCCACCGATCTATCAACGACTGATTGACAACGCGTTCTACGGATTCATGAGTCTGTCGC
CCGACCGCGATACTCGGAGCGTCTTCGATGAGGGAGAACCGGAACCCCCAGGGATCCACTCCGTCCTAGGTCGGAGATCgtacatcgacgacatcctaAT
CGGTGGTACGTCGTGGGACAATTTGTTCACGAAAGtcgagcggctgctggacgtcTGCGAACAATGGCATCTGTCCATCAGTGTAGAGATGAGTGAGTGG
GGTATTTCCCGAGTCGACTACCTGGGCCACAAGGTCTCTGAAGCCGGAATTGAAGCAAAACCGAAGAATCTGGAGTCGCTCGCGGCGTTAGACTTCCCGC
GCACGCTCAAGGGTCTGCAATCGTTCCTAGGCAGCCCGAACTACTACCACCGGTTCATCGCGGAGTTTGCGGTCTACGCGACGGCACTGTA