Description :
From Genome Similarity Track
Location :
Scaffold_1225:9- 4340
Sequence
4331 bases(100 bases per row)
TATTCGGGTGAATCCATAGAGGGCTTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCACCCGGTTCCACTCGAACAGGCCA
AACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTAT
CCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCAC
CCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGT
TTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCTGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTA
ACGCATTACCTTTACCAATCAGCAGGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATAT
CATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGTTCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTCACA
GACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACC
CTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATTGGGATC
CAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGC
GTTATCTAAGGGCCGACTCTGGGGATCGTCCCCTGTCCTGGATCCAACTTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGA
GTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGAT
TCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTC
CAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACC
CACGGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCT
TTGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTAC
CATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAGATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGC
GTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTAT
CTAGTATAGACACCTCGGCACCACTATCTAGGAGTGGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACATTGGCTTGTCTGAACCACTTTCCTGGGGC
ATGGTACTTCCAGTATCCACTAGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATTCAGTGACCTGACAGACCTTAGGTTGA
TCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATACCCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAG
AGACTTCGGATCTGGCAAACTCATCCACTTGGTGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGT
CCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGT
TTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCC
GACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCAT
CCAGATTCAGTGTGCTTCCGGGATCCTCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTA
CTGTATCCCCCGGTCGAGAGTTGCCTCCTGTCTTCGCCGTTCGATCGTTGGATGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACC
ATCGGATCCCGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACGCGTCGAGCTGGGGCCGTAGGTGTCGGAGCTTTTTTGGCGATACTTGCCAGA
TCCGACAGCCGCCTTCTTCTAGCGGTGTTTCGTGCGATCCACAGCCCGCAGCACTTCCTCAAGCTCATCTACGGCTGGAAGTCGTAACAGGGTCAGCCTG
TCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATTCACGTGTTTCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGAC
CGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTA
CTGGGTCTAAAAGCTGCGCAGCAAATCTGGCCACTTGTTTCTGGTGGGTCTGCCCAGCTGTCGATACCAGTTTCTGGCTGTCCCCGCTAGCAGATCCGCA
AAGGTCAGACACTTTTCAGCATCTGACGCTTGGTCTCTCATGAAGGCCGACTTGACTTTGCTGATCCATATTCGCGCTCAGTCTTCGTCTTGATCCTTGC
CCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCTCCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGA
AGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGGAGC
ACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGG
AAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTCGAGCCTGATTTGACGATAATCCCACTGGCTTCTTGCTGGATCT
GGCTCGATCCTGGATGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCCTCGGACACTCGCCCGC
GCTTCCAACATGGATGCCCCGGAGGGTCCTAAAGTCATGTGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACG
CAGCTTGGCTGATCCTCGGCGATGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGATGGACTTAACTCTAGCAAAGAGGTCCCGCGTCGCGGATGC
TATGAGATCCAGATCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCTGTAAGCAAACGTAATAGATCCTTGACTGCCACC
AACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGT
CGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTT
CTTCCGCGTAGTCTTACTCATCTTCGTCTTC