Description :
From Genome Similarity Track
Location :
Scaffold_198:9- 4246
Sequence
4237 bases(100 bases per row)
TCATGTATGGGATGATCCACCAGCGGTCCTGCATACTCTTCCACAGCTTCTTCCCCTCGCTCTGTAGTTGCTATAGACGCTAACGTTTGCCCTTATGTAT
ACCGCTGTGATCCAACCGAATCATATCCCGGTGATCGAGATATCATGTTAGATGCCATCCACAAAGCCAACGAAGCTCCATGACCTAGAGTTATATCGCG
ATCGCTGAGGTTCTTAAGCTGTAAATACTTGATCTGGTCAGGCCCACTAGTCACTATCGGCACCCACGCCACGTCTCGCCTCACCCAAAGTTTGGCCTTA
GGTGGACCAACCCCGACACCTACTTCCGTCGATTTGCCCACCGGAATGACCACATGTTGTTCATTCAGGTTGATCGCCTGCATGGTTGATCGATAAGGTG
GCTTCCTTCCTGCCAAACCAATACGCACCTCGGCTGGTAGACGTAATGTTCGTCGGCTAGATCCAAACGAATGCCCGCCGGAACCATAACATTCATACCC
AATATGGCTTCTTGGCCGACTTGATCACCGACCAAAACGTCGAAAATATACACCAACGATCCTTCCAATGTTATCTTGATCTTCGTCCACCCCGCCGTCA
TATATGCATTTTCTCCAATTTCGACGCACTCTTGTGTTTTACTTTCGTCGATCACATATCCCACCTTACGAGCAAAGGTAGAGGATCGACATTTCAGCTC
TAGAGTCGAACAGCATAGTGGCTTTCTCATTGTTGGTCTTGCCCGTCGATTTTGCTTGCTTGAACCATTTTCCGGGAGTATGTTATTTCCAATACCCGCG
CGATTCCCCTGGTGCGAGGTCGAGCTCCATCCTCACAGGCGATCGGGCGTAATCGTTCATTCTTTTCACACTTGATATTGATGAGACCAATCTGGAATCA
TTATGTATATTAGCGATCGGATCGATCCGATCGTAAATCTCTTGATCCTTCCGTTTTCCTTTAACAAATGCATAAATTCAAAACCTAGAACGCTCGGCTC
GTGCCAGATTCCAACCTGGTGAGCGTCCTAGTTTAACATCTCATCCACATTGAGGGGGGGGGGACATTCCAACATGCTTCGTGGGCACGTACCACTTTCA
GATCAAATTGAAAAATTTTCCATGGGGAATTTGCCACTCTCGTGTATCTGTCCGCATGCTGCAAACACGAAGAAACATTTGTCAGAAGGATGTCCTTTGC
GACCACACTTCTGGCATGTCAATCTCTTCCAGCACCCTTGATCGTCGTGTCTGGTAGATCCACAATGGGTACACGTCTTCGATCGTCCGCCACGATCGTG
TCCATCCCTTTCACCATTGTTCTTCTGCCAGGTGCGGTGATCCTTGTCCGATTTTTCGTGGTTAGGTACAGTAGTCACGCAAACTCGACGACGATCCACA
TCTTCATCGGATTCAATTGAGTCCTATTCCGGTCCGCTGCTTTCGACTCTCTCGCGGATCGCTTGCACCGCCCGCGCTGTCTTCGACGACATCGAATTGG
AAAACGTATTTGTTAGCTGACGAAATTGTTCATTCCCATCGACGCTTTCATCTGGCGATTCTCCATCCGTTCGCACACATGTACAGTTTCCTCCACCTCG
TCAAAATCCATCAATCGCAGTAGTGTCAGCTGTTTTGCCAGATCACGATCGGCCAGTGTAGCAATGAAGTGCTCCACATGTTCGCGACGTGTGGCCGAGG
TAACCAACCTTTCTTCTTTGATCGCGATCTTGGCGTGCTTTGATGCGGCATTAAGGCGATGCAGCTATTCCAGCGGGATTTCATCTGATCGCTTCCGTTT
GAGATAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTTCCACTTGTGCCGAGTATGTCGATTCAGTTGGTTGTACCAGTTTCGTGCTGGTCCTATCAACAGATCGCCTAACACCAAACACATTTCT
TCGTCTGGCGCCTGATCGCGCACGAACGCCGACTTGACCTTGCCGATCCAGCTTATGGCCTTATCTTCATCTCTGTCTTTGCCACTGAATTCGTTTAGCT
CCGTCATCTCTGACACACGAATACGTTGAGGAATTCTATCACTATTCTGCGACGTTTCTGCGGTTGCCACCATCGCACGTCTCCTCTCTTCTTGGCCAGA
ATCATCGGGATCGACGTCTTTAGGGTCAAAAATGTCCGATCGACTGCGATGCGATCGAACCGATTCCATCTCAACATCTGGGGTGTATGCTTCTTGATCT
CTTGTATTCTTGATCCTTTGTCTAGGGTAGATCGCTTGATACGCTCTCCCCCTTTGTTCTTGTTGAAAACGTTCCATGGCCACTTCGAGGTACGCCTGGT
GTCCTTGCGTAGCCAAATCCATCTCTCCTTTAGCACGTGCGGTCGTCGATCGTGGTTCGATCTTTATCGCGCAGACGTGCCGCCCCACTTGGGCCTAGAA
ACATCCGCTGAATACCGATCGAATCACCAGACTCGATTTCAGATTTAGCTGACGCGTACCGAGACGATTCGGTGTGATATTCTCTCAGGGTTCTACGATC
ACTGCGTCCACATGATCCGTAGGATCACAAGCACCCGTTAGGGGAGTTAACTTGTCGTATAGCGATCGATACGCGCGGGTAACCTGATCTTGGTCGCACT
CCAACATTTTGTTCGCGTCGAAAAACCCTGCGGCTAAACCTGCGTCATGTAGCAGCCGTATGGTCCCGTTGATCTCGTCCATCACGTTAGACGCTACTGC
CGGTGGGGGTATCGGACCCCGGATCCCTCCGATCAGCTTGGGCTTCAGAATCCAGAGCACTGGGTCATTTGATAGAACATTATTGAGTTTCTTCCAGTGG
TATTTCTCCTCCAACTGATCCAGCTGCCAGCCTTCCAACTTCATATTGTCGTCCACGAACTTGATCGGTCGGTAGATCGATTTTATACTGCGATCGTGCT
GATCCGATCTTGTCGCTTCTTTCTTCACTCGTGCTGTCTTCACGTTCTTTGTCTTTGACTTTGCTTGAGTAGTCTTGGGTCATAACTGTTCGGTTGTATC
CAAAGGGTTTTCACCCAGCAGATCGTGCTTTGCGGCACGATCCGCGGTAGTCTCCGAAGGGACCTCAGGAGGGGGTCGAGGTTTCTCTCCCAGATCAAGC
AATCTATCTTCCTCTTTGATTTTCTTGTCATCAGAGCCCCTCCCAGAACTTCGTTAATCTGGGGATCCTTTAAAATCACGCGCCGGCGGCGATCCCTCTG
CCCCTGACGCTTCATCTGTCTTTATTTTCACCTCTTCCCTCCGGGACTCACGGGGAAATCCCGAGTCACCAGAAGATCCGGGCACGCGCACCACTATAGT
AGAGTGGTGATCGCTCATTTTATGAGGCGATGCCAACTCTTCACTGGTACCCAGACGACCGACTAACGGAGGGGGCACTCCGATACCGTGTAGATGTATT
CCCTCCTCACCTTGTGTACCTGTTGGTAGGGCGGGTTGCACTCTTCTCGGTGGACTCGTGTTGAGGGAAAACTTGACCGTGTCAGGGATGGGGTTTGTGA
TCGTGTGGAAATCTTCACACGATCACGGATATACTGGGAGGTTACTTGATGTAAGCCACCCATATCTCAACGAGATCTCATTGTCCACTATGTGGATGCT
TGATATGCGAGCCTTCTGACCACTTGAGCCGTCTCGCGATCTTGTGCCTTGTCCTTTACGTTCTTGCTGCGTCCGATCGCAGTTGAGGGGAAAAGTGAGA
ATTCTTGACCCCCAGCCAATTATCTGGGGATATCACTTGATTTCAGTAGGTGCGGCTTTCTTGACGTCGGGAGGCCAATATTCTAGCCCGGAAGAGAAGT
TGACGCGTGTACTTAGAAGAAAATAGAATTCTGTTCA