Description :
From Genome Similarity Track
Location :
Scaffold_1530:9- 4082
Sequence
4073 bases(100 bases per row)
GGATCTCAACCCGTGGATCCCTCTGCAGGATCCTTTAAAGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCT
CTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGGG
GTACCGTCCTTCGCCAACCACCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTG
GTCCTTGGATTACGGTAGGTACCCATTTTACGCCCCGAGTGACCCACAGTCTTTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGTTCCCCC
GGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCTGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAA
CAAAGTGTCCCATCCGCCAGATCCAACCTCACTTCGGCCGGCACCATGAAATCCATCCCAAGGATGGCGTATTGACCAGCGAGATCCCCGACCCAAATGT
CAAACCAATACACCAAACAACCTGCAAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCG
ACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTG
ATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACAT
CCTCAGATCCATAGATTCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTC
TCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAACT
GACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGCTCACAAATGCATAAATGCAGTACCTAG
AACGCTCGGCTCGCACCGGATTCAAACCCGGCGAGCGTCGTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAAC
CATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGAT
GACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCC
GTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCA
GTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAG
CTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTCC
TCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTA
CCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGAATCTGCGGCGAG
CGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACCTGTTCCTGGTGGATCTGCCCAG
CTGCCGATACCAGTTCCGGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCGGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACT
TTGCTGATCCATGTTCTCGCTCGGGCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACG
ATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTAACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTC
CACGGATTCCATCTCCACGTCTCGTGCTCTATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATC
GCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGCGCCTGTGGCCGTCTGGTCCACTGGCGATACCGGATCCGTGAGGCGATTACCTT
GAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCTATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGC
CTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGAC
GTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGG
TGATGGACTTAACTCTGGAAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGAT
GCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGCTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGA
CGTAGATTCAGGATCGGCATGACAGGATCTTGATGCAGGAAGTCGCGTGAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCTTGACC
TGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGT
TGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACCTGCGTCA
AGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTTC
CAAAACTCCATCAATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGGCTCTTCCCCTGGCTCAATCTTCACTTGAGC
ATCTTTTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGTTCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGG
ATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAG
GGCGGGGTCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAAT
CTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTCGCCTTGCG
TGTGTGTTCCCTTGCCTTTGTAGTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGTCGGGATCTTGAGAGTTG