Description :
From Genome Similarity Track
Location :
Scaffold_2478:9- 3789
Transcript NameFunction/comments
Phyta_totarag14533hypothetical protein

Sequence
3780 bases(100 bases per row)
TGGGTGCTATATCGACACGAGTCAGAACCAAGAGTGTGTTGGAATTGGTGAGAACGTGTATACGACGGAAGAAAGAACTCGGATCAAGGTCACCCTAGCC
GGATTGCTGGTGTATTTCCTCGACATCTGGGTGGGCGATCTatctggccaagaagccaTCTTAGGCATGGACGTCATGGTTCCTGCGGGGATCAGACTGG
ATCTGGCTGACGGGTCGATCCGCCTGCCCGACGAGGTAGAGATCCGACTCAGCGGACGCCGACAGCTCTATAATGACAAGGCGAGGATCTTGAAACTGGA
TCAGTATATGAAGATCGAGATCGGAGGGTCGGTGGAACTCCCGATGCGCCTGCGAACGTCGGAGCATGAGAAATTATGGATCACCCGTGGTGACCAACGG
TTACTAAAGGACCTGGACGAATACGACACCTGCAGATCACCAACGTGGGCGAGAAGAAATTGATTCTGCAGGGCGATGAGAGGATCGGGATTTGACTCGC
CAGCGACCgtgttcctcgtcttccaggATTCGTGTCGATCTGATCTTGTCGTTACATGGAGTGGCAGAATCTAGCTTTCTAGGCTACCGCCGACGGGCGG
TCTGCCGCGCAAGAGGCTCCGGAACCAATACCAGAGCCCACCGTCGATCGTCCGACCTACCCTACGCCACGCGCCATACTTCAAAGGGTCAAGATTAACC
AGATCACGCGTGGATCCGCTAGTTCACCTGACGTGAAGTGTAGATCGGATACCCCATCGTCCGATCGGGTTATCACTGGTGGCGAAGGGCCGAGATCGAT
GGAGGTNATCTACCCACGGACGCCGAGGACGGACCAAGATCAGCCAGAATTGCGATAGTTGAGGCAGACCCGGTGTCGGATCCAGCGTCGAGCGCGTCGA
CGCAGGAAGTTACCTGTACGAATAGCGAAGTCCGGTCAGAGCCCGACGTCGCGAGACCACGGGCCACGCTGGATCCAGAAAACCGAAGCAGATCCGAGGT
GGAAGGTGAGAAGCCCGATCTACCGTCGACGGTGATCTGGGGCGCTGGATCGTCGAGGGATACGGATCGCAAAAAAGAAATTGGAGTCTATCGACGAGGA
CCGGATCCACTACCATGGGGGTGGTGAGATGATTGTGGAAGACCTCGAAGGCGAGTTGGCAGTGCATCCGGAAATTCTCATCTCCACGACATGCGACGTG
ATGATCGAAGATATCAAGGTGGGCAATCTGGAGTTCAATACACCGGAGGAGATCGATCGACTACGTAAGAAGATCTGGCGGAGAAAACACCTTTTGATCG
GCAAGGGCAATGCACTGCCACCGGCAGCCCGATTATGTGTGACATCGATGTAGGATATGCAAGGCCGATCGCGCAGCGAGTGCGGCAAGTGGCACCACGA
TTCCGAGAGAAGGTGTCAAATCTGACTAAAGGTTTATTATCGGCCAGGATCATCAACCACTCGACGTCCCCATGGGCGTCACCGATCGTGATtatcatca
agaagaactgTGTGGATATACGATTATGTATTGACTATCGATTGGTTAACGGCCTGACCCGGCTGATGATCTACCCGATGCCACTGATCAACGATCTGCT
CGAGGATCAGGACAAGGTATTATGGTACTGCTCTCTGGATATGGCGAGCGGGTTTTGGGTGGTGCCGATGACCGATCGAGCTCGTGCGATCTCGGTGTTC
ATTACTCCGTTCTGCCTGCTGAGTGAAATCAAATGCCATTCGGCCTCAAGAACGCACCCCAGATCTACCAACGGCTCCTGGATAACGCACGGTATGGATT
TATGCGGATCCTGCGATCAGAGAATTCCAAAGGTATCGTGGATCTGTTTGAGGATGGGGAACCGGAGGATCCAGGACGCCCATCGGTGTTGGGACGCAGA
TCCTACATCGCCGACATCCTAGTGACCGCCGGATCTTGGGATCAGCTATGCAATCGGGTGGAAGATCTACTGGAAGCGTGCGATAAGTGGAACCTATCGA
TCAGCGTAGCAAAGAGCTTCTGGGGGTTATGCAAGGTGGACTATCTAGGATATCGAGTGTTGAGTGAAGGTCTAGAAGCCAACCCCAAGGATCTGTCGGT
ATTAACGGATCTGCCTTTCCCTAATTCACTCagatcgatgcagtcgttTATGGGCAGCTTAAATTATTACGGCCGCTTCATAGAAGACTACGCGATCTAC
GCGGCGATCCTATTCGAGCTGCGGGAGGTGGACTTCGCCGAGATGAGAACACGTCCTGATCTGCGTCAGATTTTGGGGAAACTAGATCAGGCGCCACCCG
ATCCAGCATCGTCAGGATTGGGGGCGCTGGATCCAGGTCAACCAGACCTCGACGTCGCGGACGAACGATGGTTCCGAGCTCACAAGGCTTTCACaatgtt
gaagaagaaggttgcGACGACACCGACTCTGCGTCACTTTGATCCAGATCGACTACCAGTGGTGATCGTGTATGCCAGTTAATGGAAGATCTCGGCTGCT
CTGGTGCAAGAACACGATCGGATCTACTGTCCTGTCACCTTCGCCAGTCGGACGCTCAAATCAAACGAGTTGAACAACaatgtggtggagaaggaagtgc
tAGCGTTGCTGCCGATCCTAGATCTCAACTACAATATGCTAGCGGGGCGCCAGATCCGGATCCTTACTCGGCACTCAACTCTGGCCTGGCTATTCAGATC
ACCCGGCCTCCAGGGCCGACTAGGTCAGTGGGCAGCTCTCCTGTCACCTTGGATCCTCGAGATCGTGAAGTGCACGAAAGGAGAAGACGAGATCCTGGGG
GCGATCGCCACCAATATTACGCCTAGATCCAAGGTAGACGAGGCCTTGATCGCGATAGCACCGAAAAGGGGGCCTCGACGTCAGATCCAGATGCCGGCCC
CGACAGTGAAGGCTGATGAAGAgctgttggtggtgagcTTCGATGGATCCGCCCGCGATAATCGGATAGGAGGTGCGTTCGGAGCGATCATATGAAAATT
ACCTGAGTGGAGCGTGGTGAAGGCCAGATCTGGCTACGTCGAAGGTCTTACAGTCAATGAAGCGGAGTACGATGGCTTACTGCTATGATTTGAACAGCTG
GAAGGCTTGGATCCGGGGCGCCTAGTAATATGTGGTGACTCTAATCTAGTGATTCGGCAAGTGAGAGGAGAGATCGACTGCAAGGCACCCGGGCTGACGT
AATTAAAGCAGAAGGCTTTATATCTGCTGCGGATCTGGCCAGATCACGAGCAACTACATGTTAAACGTAACTGGAATGATAGCGCGGATAGCCTGGCGAG
CGCAGATCTCCAAGACCTGATCACGTTGAATCGACTTGACGAAATTCTGGTAGTCGGATCCAATGATCAAGTCGCCCGGATCCCGCCAGCGGCTACTCGG
TCCGGTGCTCGATCTAGATCGAACCCAACGGTCATGCAAGAAGAGTTTGTCCGTGGGCTGCGGATCGATCGGGTCCGAAAAGCACAGGATGAGGAAGCGT
GGATCTCGGGTATGAAGAAGTACTTGGCAGGAGACGTGGTGAATCTGACGCAAGACGAAGCTAGATCTCTCGGCAATATTGCGACTGATTATGAAGTGGA
TAGCCAGGATCTGTTATTCTACTGCCCGCCTACCAAGAGATCCGAAGCCGACCGCGACGGATTGATGAGGCTGGTTGCACCAGAGACGCTACACCAAGAC
ATCCTGCACCATTACCACACCAGTCTGGAAGGGGGTCATCAAGGGATCGGCCGTACCTATCAGCGGATCCGGGATCACTT