Description :
From Genome Similarity Track
Location :
Scaffold_2102:9- 3214
Sequence
3205 bases(100 bases per row)
CGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAATAGCTCATTGATCA
GAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCAC
CGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCAACAGTTTTTCTCGGAACTGAGGTGCCACCTTC
CGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGAT
GTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGT
CAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGTTCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATGTTCGGTCTTTGTC
TGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCGGTCA
GATCCAGCCGGTCCTCTAACGAGTCTAAACCCGACGGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCT
TGGACCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCGTCCACCGACCCTGCGTTATCTAAGGGCCGACTCTAGGGA
TCGTCCCCCGTCATGGATCCAACCTTCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGTCCGATCCACCA
AGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTTCTTTGTAGCGGCGGG
ATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTATGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGAC
GTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTCTTTCATGTTCCACCCAC
TTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTT
CCGCTGAGCTGGATCCGCATCTCGTCAGGAAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGCACCATGAAATCCATCCCAAGGATGG
CGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACAC
GCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATCGACACCTCGGCACCA
CTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGG
ACCCTCCTGTTAGCAGATCCATCGATCCAACATCCTCCGATCTATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCGCCCTTGGT
AGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCA
TCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCTTGCTACCTGGATCTAGCGATG
TCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCT
GGCAACATCCCTTGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACC
CGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCCGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGA
TCCGCACTGTGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCAGTCGAGAGTTG
TCTCCGGTCTTCGCCGTTCGATCGTTTGCGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGA
GTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCGTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGG
TGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCACCG
TCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGGTGTAGGTA
TTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAA
TCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGA
CGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCATTGCCCGTGAACTCCTTCAGATCCGATATG
GCTGA