Description :
From Genome Similarity Track
Location :
Scaffold_756:9- 3185
Transcript NameFunction/comments
Albla_Nc14141380phosphatidylinositol kinase (PIKL4) putative

Sequence
3176 bases(100 bases per row)
CCCTAAACCGTAAACCCTAAACCCTAAACCGTAAACCCTAAACCCTAAACCGTAAACCGTAAACCGTAAACCGTAAACCGTAAAGCCTTAACCTAACCCT
AGCCAATAAAGCAATCATCTGTGTTTGGACTGTTACCTTTGATGACGTAGCCTCCAAAACTCGATAACAGAGTAATAAATCTTCAACGGGGGCATTTCTT
GATTCAGTTTACGTGAGCGTTGTGGCTTTTATTTCCGTACGTGTGAGCATGCATTCGATAGCAGTAGAATAATACGAGACACATTTATTGAATTTTATAA
TATTTCACTTGTGACTAACGCGATCTGCGTCTATAAATCTATCAAATTCTTGATGAGCTGCTTCATTGACAGATAAATTGGATGCATCCTTCACTTTACA
TCCATGTGACTGTAATAGTGCTTAATTTTGACACTTGCGTAGTTGTTGCAAGACACTTCTAGAGAAGAAAAGTATCCTCTGATCTCTTGTACGCCAACAT
TCCCAGAGCCGAGTCGTTAATACGTTGACAGGAAATCGCGAGAGACGATGTCATATACTGCGAGCTCGTAAGATATGAATTAAGGCCTGTAGAATTAATC
TTGATAAAAGAATTTCGCTTTTCTTTTAGATTTTGGTGCTAGGTCCTACGTTCTACTTTCGCTTTATTGACAATAGAAAACTTTCGATACTATGATTGAC
GAGAGTGTTAAAGAGGTCGGACATACATATTGGAGAACGATGGAAGATTATTTATACGATCTCATGAAGAAGCTAGAACATTGGGACAGCAGCGTCCGCC
AGCTTGCCTAACTGAAGTACTTCAATGCTTGATTCGTCTCCAAAATGACTGACAAGGCTCGATTCAAAGTCATTCTGACCTGTTGATATATGGCACGCTC
GCTAAGTTACTGGATACTGACACTCGCAAAGAAGGAAACGATAATAGAGAATTAACTTCTTTGTGCTAAGTGCTTGGAGTCGATTGTAGCAATTGACGCA
GAATACCTGTCAGGCAATATGAGTTCCAGGATCCATTATAAAAGCAAATGAGTGACGGTGGAACACAAAACGGTGGAACTAGCATGTGTCTTAGTTGATC
GATTCCATGAGTACGGAGATCTTTCCACACAAAAGAATGTAGACTCTGGTATTTACAATACATCAGCTGCTTCGATTTAGGTGAGAACTTACTACTGGCT
TGGTTGTGCGGAAATCGGATCATAAAGCTGTGAAGGCCAGCTTGCCCGGATGGATAAAAAATCGGTTGGAAAATTTTGGTATCTGCGCATCCGTTGATCC
ATATGTTTCAACACACCACAACATAGCAGCACCATCTAGTTTCTATCCAGCCAATTCTGAGGATGTTGAAGATGAGAAACTCTATGACCAGAACGCAACA
CTCTACGAAAGATGTGAAGCAACATACGATAACTGGATCACTCAATGGTGTAAACGACTTGTTCAGCTATCTCAACCAACAGAAAAGAAGCTTTTCTGGG
CATCAGAAGAAGCTCTAGCCAGTTGCCCCCAAGTCACGTGCTTCTTACTGCCGTATATGATTAAGAGCGTTCTACGAAGTAGAAACTCACATAGTCACCT
GGAGATTAAAAGAGAGATCATGTCTGTACTAGCAAATCATTATCAGAGCGACGGAACCTATTTCGGCACAACTGTATGTTTGGAGATTGAAGAACCTGCT
TCAAAGAGTCATAAAAAGACTCTGCTTCCAAGCATGCTCGAGTAATATCGGATTACTATACAAGTCACCAACAACAGTGTACACAGACTATATCGTCGAC
TTTGAATGAACTCAAAGGCTGGGTATTAGAGCACAAAAAAACAAAAATGCTTTGGCTGGCGACTCAGGCTTTCCAACCCCTGCACTATCAGAACTGGATG
ATCAAGAGAAGAAGAACTTGTAGGGTTCTTGAAGGATATTCCGAAGCTCGTATTATCGAATGCGTCATACTCAGTACGAAACTTTCTTAGGGCTGTTTGA
TGCTTTGAAGATCAACTACGTCAACAAAGCAACTTGAAGGCAAGCCATTGGAAAAGTTGTTCGGTTAACCTCGATCTATCTTTGGCGCATGTATCGGTAA
TCATGGAGAGTATCTTACACTTGCGACTACTATTCAGCAGTGTCAACGAGACAGATGCTCTTCACGGTCTTACGAAGATCGTAGAAATAGCAGGTCATGT
TCAACGCGATACAAGTATACAGAGTACCAGCATGACCGTTCTGCTTCATCAAATCGTGGAGAATGAGCAGTTGGCTCAATAGGAGGATGCATTGACTTCT
TACGGTGACGCATTGAGACAGATACAAGCACTACCCACTCACTCTGAAATGGAAGATATATCAGAAGTGCAACTCGGAGACAATGTAAACGGTCCGTCAA
AGTCACTACGCGAAAGGCTGTACAATGGCGCTATTCGGTACCAAATAAAATTGGGGAGTTTGAAAACTGCCCTTCAGCAGATGAATGGTATCGTCAGCAC
CGAACCAAGATTTATGGAAACTTTTCATCAGCACGTGTTGGAGTGTACATGGCGCTTGTCACGCTGGGTATCCGTATCCGAGCTACTACAATCCGACAAA
AACAAATTTTCTGCAATTTGTTCCAGAGTGCCAAAAAATGCTCCAAAAGATAGCAAAGAACTCGATCAGTTGCTTTCATTCCCCTCTTTTCTCAGTCTAA
GTAATTCATGTGAGGACAAAGCAAATCTACAACTTGCCCAAATCCTGCACAGTATTCACATGAACGATGCCGAAGCATTATCACTCAACTTGACAGCCGC
TCGGCTCGAAATCATGGTTCCATTGGCTGATGCACTAGATGAATCATATAATAGTGCCTACCCTTACATTCATCGACTTCATTTGCTCCATGAAGCCGAA
GATGGTTTTGTTGCATTGAGGAAAATCTCGGACGTGTCTAACGAGACCGGCCGAGCGGAACTATGGAAAAGTCAATGCAATTGGGAATCAAGGTACAACT
TGCTGGCAAAAAGCTACCGGTTCCGAGATCCGGTTCTTGCTGTACGGAGAGTTCTGTCTCTTGAAGCCAACCTCGTGAAAGTTTTGTCATTGTTATGGCT
CCAATATGCCAAAGTTTATCGAAAAACGGATCACCTGTTGCAGCTATCAATGCCGTTGAGCATGCAGAGCTTCTTC