Description :
From Genome Similarity Track
Location :
Scaffold_785:9- 3121
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_785-snap-gene-0.6C2 domain containing protein

Sequence
3112 bases(100 bases per row)
TCGTTCTCCAAATCCCTCGAGTACACATGCAGCGACAAGTACGAGACGGACTGCAGGTTCTTCAACTTGTCAAACACGAACTCCTTTTCGGGCCAGTTGG
GGTTACATGTACCATACACCGTCAAGCTTTGTTTTCGTTCTTGGTGCTCGAGCTGGCCTTCGCGGTGAACAGGGATGACAGTGAAGTAGGCACTCGTCTT
GGCTCGACGACCCAGCAAATGATTTCGATGGTGGGCCTCCTTTTCACCCCGATTCCGTCGGAACTGCTCACCGGAACCAAGCAAATTCCTCGCACTGTGG
ATGCGAAGATGAAGCACATATCCGTTGCTAAGATCTCGTCGATAACCGCTGAACAGTCCAGGATACGATAACAGGAGCGAGAATTTCTCCTTGCGCCAAC
TCGCCGACGTGCCCACCGCCGTCGAAGTTCGAATCTGCTTACCCTTGTCAATGGTCTCGACAGTTTCATCCTCGTCGCCGATATACCCAGATAGTGCCAT
GGACGACGTGTCGTCGGACAAATGCGCGTCGGATGCAAACGACTGCATCGACAAAAAGCTCAGCATCTTACCTGGCGAGTCGGCAACACTGAATCGCTGT
AGCATTTCAGCCAAAAGTGTCGCATCGCCGATCACTTCCGTCTTGATACAGAGTTCCCCGAGGTGCTGCGCGTGCCTCTTCATCCAGGGTTCGGGCATGA
GCGCGTAGCGTCTTTCCTTGGCGGTCGAGGAAATCGATGTGGTCGTCGCAGAGGCGTGGCACAAGTCGGACAGCGGAATCTGAACACGGCCCAACGGAGT
GCTTCTCGTCATGTTGTGGTCCTTTACATGGATCAACAGCGAGCCAGCTTTTTCCAGTGGAAAGTTCTAGAGATGTAGAACGGTCAGTCTAATCGCCCAA
GCGTTTCAACTCGACTCGCAGTTGTAACTTACATGACCCAAGATGAACACTTCATTCCCCCATACCGGATTCAGAGTCTTCTGAATGACTGCCGTGCGCT
TCTTCTCCGACTCGACCGACTTGCCCGTCGTGCGGTCGGTCAGCGACAGCGTGCAGTATGGATCACTGTACCCGCCAAAGTCGACCCCCGTGAGGCCATG
TCCACTCTTTATTTCCACCTTGAGCATGGGCTGGTTGGAGGGCATGTCCAAGTGTCTCTCCGAACGCACTTCATTCTTCCCGAGCTTGGCACGATGCGAA
GAAACTTCAGCCTGTGCGCGGCGAGCAAACAATCCCGACCGTGCTTCGGTTGCGGCGACACCCGCCTCGACGCGTTTGCTTCTCTGCGGGGATTGGGGCG
CGCTGATGCGCTTACACTCTTCGATGCATACTGAGGGATCGATCTCGATCAATGCATACGGGTTCGTTGCAGCGATTGTCGTCCCAGCTTTTTTCAGATC
GTGCGTGCCCACGACGCTCACTTCAAGCAAAGCTTGGCCTTCAATACCGGCTCGAGATTGGAAGCCTTCGTCGCTGGAAGTCGTTTCACTATGCGCTCGC
GGGAGCTGTGCGTTCAAGTGATGGATGCATCCGTTCAAACCATAGAATTGCGGTTCGCGGGCTTGGTAATCATTGACAGCACACGCGATCCGTGCGCCGT
CCAAGCTGCACGCTGCTTCGTGTAGCTGATGCTGCGCGTTTTCCAGCTCGAGCTGCTCGACAGATAGCTCGTGGGTCTTGGACGCGACTTCCTTTTCAAT
TTGAAGTCGTCGGTTGCGCTCACCAAGCGTCTCGCCCGCAAGTGAGATCTTGAGCTGAATGGAACCGAGGTTTTCACGTACGGCCATGGTTTCCTCTGGT
TGCAGCGCGTACCACTCTGTGTGGGTATTGGTCGACACTCCGGCCAAGCTAATGACCACCCGTCCAAGCGGATCGTTCTTGGTGTGCTCATCCCAGTCCA
GCACACGAACAAGCAGCTGTGATGCCTCGTCAATGCGATTAATGCGACCGAAGATGTGATGTTCGTCTTGCCATGCAGGGTTCCTCGTCTTTTCTTTGAT
CGTCGTTCGATGGATCTCTCCGCGGATCGGCTTGGCCCTCGTATCCAGTAACGTGAGCTCGACGAACGGGTCGCTCGACTTGTTGAAGTCAGCGGCGATG
AGATCTTTCGCACACAAGACGGTCACTTCAAGGCGATTATCCGTGTGGTCCACACCATCAGTGACGATGCGATTTTGCGGCGCGATCGTGTGCTGGAGAC
CTCGGAAAAAGTGGACCAGATTGGGACCCGCAATGCTCATCACGAGGTGCAGCTTACCGTGGTCACGGATCATGGTCTCTTGTTCTTTTCTCTGGTTCCG
TGGTGATGACGAGCCACCTGTCACGTAATCCATCACGGTCGGCTTGTCCGGTGGCGGCTCGATGCGAAAGCTGCGGTCCACGAGCTCCGACTGGCCCGTG
CTAGCCGGTGACATCTGGAACATGGACAGCGGCACTTTGACGAACCCGAGCGGCTTGGGGTTGCCCATGACCTCATGGTCCTGCAGCTCAACGTGGATCG
CCTCCACGGTCGCCAAGTCAACGGCGTGTCCGAGCGTGAAATGCTCGTTCCACACGGGCTCGACCGTGTCAGTGACGTACTTGGTCCTGACTTCTTCGGT
ACGAATGAGCGCACCGCCTTTGCCCACAAAGTTGACCACGCAGAATGGATCACTCTTGGCGTTGGCAAGGTAGTTGACGCCCTTCAAGCCCGTAGCCTCG
ACCACGTTCAGGTGGAGCAGGATGCGAGCGGGCGGCTGCAGTGGCACCGGTGGCGGTGTGGGCCTCGACGGCGACAGCGGCGGGTCCTCGCCTCGCGGCT
CCGCGACATCCTCCGTGCGCCGCAGAGCATTGTAGATCGCGGTGACCCAGTCCTCCTTTTCGTCTTCTCTCTCGGCCTGCACGTAGAAGTTCTCCGTAGG
TGATGTCTTGACCACAAAGCACCGCTCGTAGCCTTGGTCGTTTGTCGGCGTCACGCGCGTATCCAGACGGAGCTGCACGCGGCGACGCGGCGTCCTTTCC
AGCGGTGTGTAGAAGTACTGGAGCTCCCCTGGAAACAGTCGAAAGTACCGCCGCTGGAACCGCGCCACAGGCCACGCGTTACGGCTGCGTTTGGCCAGGA
AGCCTTCCTTAA