Description :
From Genome Similarity Track
Location :
Scaffold_2213:9- 3022
Sequence
3013 bases(100 bases per row)
TGACAAAAAAAAATAAGAAAAATTCTTTTTTTCTTGAATTTATTTCTATACAGCGACAAACATTACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGG
TGAAGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGAGAGTCCCGTGGG
TACTGGAAGTACCATGCCCCGGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCG
AGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCG
TACGAACGGGAGAACGCGGATTAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTC
GGGATAGATTTCATGGTACCAGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGAC
CGTTGTATGGAGCAAAGATGAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGA
ACATGAGAAACTGTGGGTCACTCGGGGCGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAA
GAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGTGACCTGGATATGTGTCAGTGGGATCCCGCCGCTAC
AAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGC
CTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCG
GCCCTTAGATAACGCAGGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCCAAGCTCTCCAT
TGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCCCGAGCTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGGATCCAACTGGT
GGTTTCCCCTGATACCAGGGTACCTGAACCCCCGACGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAG
ACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCTGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAG
AAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCT
GATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGATGCGGAAGGTG
GCACCTCAGTTCCGGGAAAATCTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAA
TCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAA
TGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGTCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATA
TCCACATTCATCACACCGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTCGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCC
TCTATGGATTCACCCGAATACCGGAGTCCGAAACAGGTGGGTCTGGGGAAGGCCATACGGAAGTGGATCCAGTCGAAGCGGGGGAGCCAGGGGATCCTGG
GACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTAATGGAG
GCGTGTTCTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGG
AGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGCTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCG
GTTCATCGAGGATTACGCCCTGTTTGCAGCGGTATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAA
CAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAAC
AGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAA
CAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTT
CAAGAACATGAGGGGATCTGCTATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGC
TTCTGCGCGTGTT