Description :
From Genome Similarity Track
Location :
Scaffold_1266:9- 2945
Sequence
2936 bases(100 bases per row)
TTGTCTTGTTGGTTGAGGAACCCAGTCAGAGTCGACCGGCGTACACCTGGAGGAGCGTCGAATAACTTCTTTCGTGAATCGTGCTTATCGATGCTTCCAA
GAGAGATCGCAGTCCGTAATGGTCGAGGTCAGGTCGTCGTCAAACTTGCTGACGGAAAGCCACGCCGCGTTGCGCGGCGCGAGATCACGTTGCCGTACAC
ATTCGACGGATTCCGCAGCAACGACGACTTCCTCGTGATTGAGATGAACTACGCGTTCGACTGCATCTTGGGTATCCCGTGGTTGTCACGATATCAACCA
GAGATTGACTGGTTGGCTCGGTCGGTTAAACACCGCTCTGGCTTCGATGTGAGTGAGGTGTTCACACACCTCCTGGTTGCCCAGAAGGACTGGCCCCATG
TCAGGGTCGTGGACCGGTTGTCCACAATGCAGGTTGAGCAGAGAGCGAGCGATGGCCCTCTCTGTATGTCTTGCACAGCGCTGTTGCGCGAAAACCCCTC
GCTGCGAAGCGAGGTTGTTAACACTTTGGCGGTAGGGCAGGGGCTCCCGCAATCCGAGCAGGCGGTCGAGCATGAGTTCCCGTCACGCAACACGGCGGTC
GAGCATGGGTTCCCGTCACGCAACACGGCGGTCGAGCATGAGTTCCCGTTACGCAACACGACGGTCGAGCATGAGTTCCCGTCACGCAACACGACGGTCG
AGCATGGGTTCCCGCAACACACCAAGGCGGTTGAGCATGGGTTCCCGCCAAACACTTAAGCGGTTGAGCAGAGGTTCCCGCAACGCGATTCGGCGGTCGA
GCAGGGGCTCTCGCCAGTCGATGGCGCGGTCGAGCATCGAGAGCTCCCGCGCACTACCGACACGGTTGATGGTGCCCCTCCGTGTCTAGAGGGGGGTGAT
CCCTCGTCCAGCGATAGTGAGTCTTCTGTCTCGAGCAGCGGCTCGAGACGCCGCAAGAAGAAATCCAAGCGACGCCGCCTTAAGCGACGTGGTCAGCCCA
CCGCCGATATCGCAGTGAATGAGTCCATACACGTCCTGGAACACGTGGAAGGAGGCGTCGTTCGCTCACGCACACTTGACATTGAGAGCCCACCTCGCGA
AGCCTCTTCCATCACACGCCTTCCGGGTCTTTCCTGGAAGCATTTTTCTGCGCGATCTGAAGTCAGGAGACATCGAGCAGGGTCTGCTTTGATCACCGAG
TCTGCCTCGGCGGAAGAAGATCCACACGGGTCGCTACCCGACAAATCTTTCCACTTTCGTCCAAAGAACCGCTGAGCCCGAAGGTCGACGCGCAAAAGAG
CGCTTTCGCTGCCCAGTCGTGGGAGTCACCCCGCGACTCGGGCAATCCGGTATACGACACCGTCCGCGAGTTTCGCGATGTTTTTCCCGACAAGATATCA
GCTGAGCTCCCTGCTGACAGAGGCATTCGCCATGAGATTGATCTCACGCCGAGTTCCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCATGCGATCAGG
TTAAAGCCATTGACGACTTCTTTCGAGAGCCGCCGAAAAGCGGGTCACGTGCGCGATAGTACCTCGCCACACTCGAGTCCGACGTTTCTGCGTGAAGAAG
GCCACGGGTGGTTGGCGCATTGTTCACGCTTTTAACAAGCTAAACGACGCCACCATCCCAGCACAAACTCCGATCCCTCGGAAGGATATGGTACTTGACA
CCATGGGCCGCAGTGTTATTTTCAGCGCCATCGACCTGACCGATGGCTTCTATCAGATCTTGATGCGACTCAGCGACATCTTGCTCACAGCGGTGAGCAC
CTCCAGCGGGATGTTGTGGGAGTGGCTTGTCATGCCGCAGGGCCTGAAAAACGCACCAGCCACGTTCAATCGCATGGTTTCCCACGTTCTGCGCCCAATT
CGCGACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCACAGCCGCGCTGAGGGCGATCTCAGCGCCACAGAAGCTCACTTGAATCACTTACGACAAG
TGTTCCAAGTCATGCGCGAAAACAAACTGTACGCGAATTTGAAGAAGTGCATCTTCTGTGCCCCGGAGATTCCGGTGCTTGGCTGTTATGTGAGCAAAAA
TGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATCTGTGCGTGGCCCACGCCGCAGAATCAGACTGAATTGCTTCAGTGGCTTGGCCTCGCAAATTAT
CTCCACAAGTACACGAAAAGTTACGCTGGTCTGATCCAGCCATTGTCTTCATTGCTGAAGAAAGACATCACGTGGTCGTGGCCTCCCGAACATCAGTCAG
CCTTTAATGCAGTGAAGAAAAGCTTGGCGGATGCCCCAATCCTGGCGCTTCCAGATGACTCAAAGCCATTCCACGTTGTTTGCGACGCGAGCGACTTCGC
CANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCTTTCGGAGTCTAACGGATAGCCGGAGCGACGT
CCCCGGTTGGAATTTGCCGCGGACCTAGGTTGACAAGGGCTGCTGTGAGGCAGGCCCTGACCTTTTTCGGAGACGCACAAGAAGGCTGCCGGAGCGGGCG
GCTTGAGACTCTTGGGACGCCGAGAGGGCGGCGGAGTATTCTCCCGCCAATCGGAATCGGGACTTCTGCAGCGACTGGGTAGTCTGGAAGGCGCAGGTGT
TTGCCGGGCCGAGGGGTGGGAGGCTCTCCGCGCGAG