Description :
From Genome Similarity Track
Location :
Scaffold_390:9- 2796
Transcript NameFunction/comments
Sapdi_VS20SDRG_17448hypothetical protein

Sequence
995 bases(100 bases per row)
ATCAGGAATTTCATTTCATTTATACAACGCAACAAGAGAATACACGAAAGCGACATTTTCTAGAGAGCGCGACGAAGGCGGTGCTGCGCCATGCGAACCG
AAACGACACCATTCGCAGGACTCGGGTTCGCCACCGAGCTCTTGAGCCAGCACGTGTTGGCGTTGATCGAAAAGCCGACGCAACCGGTCGTGGTCGAGCA
CCCGTTGCAGCACTGCGCGACCTGCGCTGCCGTGTCGCCGTTGACGCCAAAGCTGCGGATGTCGTTGCCGTAGTAGTCGACGTCGGTGCTGACGCTGCTC
CCGCACTGGCTGGACGAGCCCGCAGAGGCGCCGGGCGCAGAGGCCGAGACGACGCCAGCGCGGGGCGTCGGGCTGCCGAGCGTGTGCTTGAGCCAGCACA
CACCGCTGTTGATGGAGAAGCCGGCGCAGCCGTTGGTCGAGCTGCACGCCGCGCAACACTGGCTGAGCTGGTCTTGCGCACTGCCCCACACCCCAAGGTT
CTTGATGTCGTTGCCGTAGTAGTCGAGGTCGCTCTTGGCGTTGGCGCACTGGCCGCCGCTGTTGGGCTGCGGCGCGGGCCCCGGGTTCTGGCCGTTGCCT
TGCAGCGGAACGCAGTTTTCTACGCACAGTATCGCAGCGTGAGCCATGGAGCCATAAAGGTCGTGGGACGCACTGTAGACTTGCCACTCAGGCTGGTGTA
GCGCAATCCAGTAAAAGCGCAGCATGCAGCCGTCGCCCGCGCAGCTCGAGTAGTCGACGGGGAGGTGCGCGGCCGGCTTGTCGCCAAAGTTGGTCGCGCA
GTCGTCGTTCTGAAACACGCGCTTGTTGTCGAGCCACACCTCGCAGGGGCCCTACCAATGAGTGCAGCTTGAGTATACATAGAGTAGTGTCGTTGGGTAC
CGTGTGGCTCGGGATGAAGCCTTCGCCCGTGTCGGGGTTCTGCCACGTCATCTTGCCGTCCGATGGGATCGCCTTCTTGGCGACGTTGGTGAGCG