Description :
From Genome Similarity Track
Location :
scaffold_1674:9- 2685
Transcript NameFunction/comments
g11614.t1hypothetical protein

Sequence
2676 bases(100 bases per row)
GCCTTCCAGGCCTCCCAGGCGAGTCATCAACCCTAGATGACTCGTGCTGCACGTACGGCTTCAACCGCCCGACGTAGAACGTCGGATGGAGCCTCATGCT
GGACGGTATGTCCAGCCGGTACGCGTTGCCGTGCCGTTCAAGTACTGTGAACGGCCCAATGAATCTTGGAGCAAGCTTGCTTGCTCCAAAGTCAGACACT
GCATGTTTAGGCAGGTTTTGAGTAGCTAACAAAACCAATGAACCCTTTTTGAATTCATTCATGTTGCCCCTGCCAACATTATCAGCGTTCAGCTTCTGTC
GATCGACAGAAGCTGCGATAGCGTCTTGCACAACCCGTATCACGGCTTGTCTTCGCTGGACAAAGTCTAGCGCGTTCGAGCTGAATCCTTTCAGCTCGTC
GTCTTCGTCCGCAGCAGGCCCTGCCTGCGCGCTATCATCGCTTATGTCTGTGCCCGGCACAGACATCGCGCGTCCGCTCCTACTCGAACGAGACGCTGCA
CGCGTCACCGCAGCTGATAGTGTGCTATCAGCCGTATTCTGCGGTTGTTCAGACGCAACCGTAGATCCTCCCCCACCTAAGGAGGATGCTACCCCGCCGA
GCATGCTCAGCAAACGTGGATGCCTCATGGCGTTCACGTAGAACGGTGTATGTCCAGTCGAGGCATGCACCGAGTTGTTGATGGCAAACTCTGCCATCGG
CAAGCACTCGCTCCAATGCGGGAACAAGTGAGCGTAGCTCTTCAGCGCGTCACCCAGTACACGGTTGACGCGCTCGGTCTGTCCGTCCGTCTGCGGATGA
TCCGCAGTCGACATTGACAACTGTGAACCAAGATGTATAAACACTTCTTGCCAGAACCGCGGTGTGAAGCGTGGATCACGGTCCAACACAATGTCGAGCG
GCATGCCATGGTGTTTGAACACGATGTCAACAAACAGTCGCGCAGTCTGCGCGGCTGTAACAGTAGCCGGGACGGCAGCAAGATGGACCATCTTGCTGAA
TCGGTCCACAAAGACAACGATGCCCGTCCTCCGCTTGCTGTCAGGCGGAAGACCGAAGACAAAGTCCAAGGACATGGACTGCCAACACTCCGACGGAGTC
GGAAGTGACTGAAGAGGAGCCTGCGAGAACGGCGCAGGCTTCACGCGTTGACAAACCTCACAAGCACGGACGTACTTGCGCACCCACTTGTACTGGTGGT
GCCGGTAGAAGTCACGCGTGAGAAGAGTGTATGTCTTCTCACGACCCGGACGCCCTGCCGTAGGGGCATCGTGATACTCGAACATGATCCTCAATCGCAG
ATCATGATCATTCGGGACGACAATGCGGTCCGCATTGTCGTCTACTACACTGTATAGCTGTAGCCCTTCGTGTACACGATACTGATGTACACGATACCGA
AGATAAGAGGTTAGCTTCCGACGCGCCACGTCAGAAGGTACTGTGAGGTATTCCAGCAGCCCCTTCGCGTCTGCATCTCTTGCATACGCGCCCTTCACGT
CGTCAATCAACGTTGACGACGGAACACTTGTCCTCACAACGTCAACAGCGTTGACGGCGACCGTCTCCGCATAGTCAGGTCGACGCGATAACGTGTCGGC
CACTACGTTGAGTTTTCCGGGTTTGTACTCGACCCGGAAGTTGTACTCCGCGAAGAAGGACAACCATCTCGCCATACGTTGCGAGATGTGCGGCGACTTA
ATCGCCGTCCGCAGTGATGCGTGGTCGGTGTAGACCACGAACGGTCTACTCCCAAGTAGATACACTCGGAACTTTGCGAGTGCATACTTCATGGCAAGGA
GCTCCTTGTCATGTACGGGATAGTTACGCTCAGCTGGCTTCAGCTGACGCGATTGATAGTAGACCACACGATCACGCCCCTCGTGATCGTGCTGCATCAA
TGCGCATCCGATGGCAATGTCGGATGCGTCACACACTACGTGGAATGGACGATCTTGGTCAGCCACTGCCAAGATCGGCGCCTCAGTCAAGCCCTACTTG
ACTGCATCGAATGCCCCTTGGCACTCGGCGGTCCAAATCCACTCAGCTTCTTTCTTAAGAAGCTGTGACAGCGGGCGAATCTTGCCTGCGTAGTTCTCCA
CGTACTTGCACAAGTACGTGGCGAGCCCAAGGAACTGCCTCAGTTCCTTCACATTGGATGGCGTGGGCCACTCATTGATCACTCTGACCTCCTCTGGGTC
AGGGTGCACGCCGTCCTTCCCGACGAGACACCCCAGCACGGGTATCTCGCTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTATGTTTCCTC
ATAAGCTCTAGCAGCTTCCGGAGATGCACCCTGTGCATCTCAACGTCCGTCTTACCATTCACAGCCCGGCTGTGGACGAACACGTCGTCGAAGTAGCTCG
GTGCGAAGTCGCACACCGAGCGCAATAGATGTGTCACGGATCTATTGAACGTCGCAGGGGCATTCTTAAGTCCCTGTGGCATGACGAGCCACTCCCAAAG
CATACCGCTTGGAGTGCTTACCGCCGTGAGAGGTATATCCCTCTCACGTATGATGATTTGATAGAATCCATCACGTAGATCTAGAGCACTGAAGATAGTG
CTCAAGGCCATCGAATCGATGATCACATCTTTTCGCGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAACT