Description :
From Genome Similarity Track
Location :
Scaffold_2308:9- 2641
Sequence
2632 bases(100 bases per row)
GTTTCCGATCGACCGTCGCTTCAAAGCGACTCGGAGTCCCAGGGCCCCGGGCTCCTTCCCGACAAAGGCCAGTGGAAGAGTGCTATCACATCTTCGAATA
GCGAGAACGGGTTTTCCCCGATCAAGGCATCTTGTGTCCACCTGGAAACAGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACCGCCTGAG
TCTTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATAAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTTTGTCTTGGACG
AGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGTGACGGAGTAT
GCGGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGA
GGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGGCTTCTTCGCCGCGAAAGCAAAGGCAGGAATGGTGCGGGAATCGAAATCCCCGCACTC
GACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACGACGCAACGGTGCCGGCCCAAACACCGATC
CGACGAAATGATGTGTTGTTGAACAACATGGCTGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGATGGATACTACCAAATCCTGATGCGAGAGAGTG
ACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGCTCAATCGCC
TGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGA
AGGTGCATCTAGGGACACCTTCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTA
AAGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCT
TCGAAAGTGGTTGGGCTGGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGAC
TGGCGCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTA
GCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACGGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCT
CAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCC
TTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACA
ACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGATGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAAC
GGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCATTAAGGCCGGAACGAGCGCGAAGTCCGACTGG
CTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTAC
CCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCA
GTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCA
CTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGG
TGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCG
CTATCACGGTCTCCCAGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAGCTCGTCTGCAG
ATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCATGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTA
CGTGGTCGACGCAGCTCCCAGTTGTTGAGTTT