Description :
From Genome Similarity Track
Location :
Scaffold_178:9- 2574
Transcript NameFunction/comments
Phyta_totarag5123hypothetical protein

Sequence
2565 bases(100 bases per row)
TGAAACGTTCCGTACGGGATGCCGTCAATAGTTCGCAGGTCTTCAAAAGATGTGGGCCCTCGCCGGTAGCACAGCAGAAGTCGCAAGTAAAACCGCTCTG
GCTCTTGGAGCGACACGTGTATGATACGGCCGATGGAGGGtacgtacttcttgtacCTTACCCATCATTTACTCTTTTTGTCCCAGCGATACACTGTGGG
AATGTCCTTGTAAAGCATTTTTCCAGTTATTTCTGGCTCTGCAAGACACAGCATAAAGAATGCTGTTAATGTTGTCTTGTCACCTCGGCGAATGAGCCGG
CGAATTTGCTCGTTCGTTGCATTTGGCCGAATCGTAGCCGCACTATGTCCGGGTAAATGAATTGCCAGTTTCACTACAGTATGCATGGATCCTTGCGCCG
GATGCCGGAAAAGACGCGTACAGGCTTCAAGGGGGATACATATGTCGCTAATAGATATTGGAGGATCTCATTGAACGACTGATCTTGAACCTGACCCTCA
ATTGTAATCGTAGTCATATCTGCACCCTTGTAGACGTACTTATAAATGTACTTCACGGCTTTGTTTGTTGCATAAACCTCTACGTTGATATGGCAATTGT
ACTTCTGCGACATAAGCGGATTGTACGGGACGACCCATTGTTTCACTGTCGCGTTTTCCTACACCTTATTTCCACGCACCAACCGATCCGCcggacgtcg
acgacgcctGTATATTGGATATTTATCCGATGCCGTTGTTGTTTCTTCAGCCAACGGCTTTGGAAACTTCTTAGTGCATTTGCCATTCTTCATGCACGGG
CTTTTCTTGTTTCTATCGCCACACGGACCATGCAACATACACGAAAGCACAGTCTCATAGAGATCAGGCTGTTTGTCGGTATCTGGCAACTCAGCCGACA
CCAAACGGTCTACATCGTCCGACGTGACAGGTTTGTCCTCAGATCTCAAGATCATTAATATATGAGCGTGAGGCAGTCCCCTCTTCTGGTATACAATCAC
GTGAATCTGAGTCGCTTGAATACTCAATACGCTTTCGTCGAGATCCTTGCTGAGCCCTTTCACTTTTTGCATAAACACCCTTGCCATGATGTTCGGTCGA
TCCGCTATAGTTTGACCCGGTCGAATATTTTCCTTAATCTCCAACCACTTTGGATTGCACGTCATCGTGGTTAAAAGGTTTGGAGCACCAAGTTCGCGAA
CGATCGCCATAGCATCCTAAAATCGCTGGTACATGAAGCGAGGGCCACCTGTAAAAGATCGTGGAAGAATTAAGCGGCGACCAACGTTACGTGTCTCTAC
TTTGGTAGCGTCCCCAGACACGTTTTGCTGGTGGCCCTGTCGCCGACTTGCAGTTGAAACACGTGTGTATTGCTGTAGCTCGTGAACCGCCGCATTGCGA
TGAGCCTCCGTGCCTTCGTGTCGGCACGCATAAGTGAGGCCTTGTATTGTCTCCAGTCTGAACTCGAGCTGGTTATTCTCAATGTAGCGaagtcgctctt
gctccGCCTTTGCCCACTGGTCGACACAATACTACTGTGTTAACCTCCCTCCGAGAAGTTAAAGCGAGTGAGTTCCGGTGCGATCATACAACAGATACGC
AACAAATTCTCGCAACGACATTGTTGTTtacgtcgttgctggcggCCATCGTCAAACTGCACAACATATCCCCACTCGTCaatttcttcatccacttctC
GATCATCGCGACCACGCTGACTACTCTCTACGCTCACCACTTTGTTCACCAGCATATGCATATTGTAAGTCCATCCCTTCTCACCATATCGACGCAAAAG
AGGGTACTGCAATGGAGCGTAATTAGGGTTGGTTTCGTAAATACGATTGAAACCTCCGTGTCTGGTGTGCAGAACAATATCGCAGTGCTCCGCTGCGTTC
GCGTCGATAATATTTGCCTCAACCTCCGACGCAGTTGGCGTATTATGTGTCTCAGGGGTTGTGTCTTGACCCACGTGTAGGCTAAGCACACAGTCGATCT
CCGGGTCTATGAGTGGCTCATGCACATCTTCTTGCTTTCCATCTTCCTCACGACACCTCGCCCGTTCCGCCGTAGCCACTTCAAACGCGGGTCTACTCCG
TTCAAATAGAATCTCTCGAGCATGTAGGAATTGCTTCGCGTAAGAGTTGTGCTCCTCCATTGTCGTGTCAATGTCGCTGACAAACTCTTGGTTCAAACCA
TCCGTCATTCGTATACGGCTTGACACACGTGCAGCACTGTCCGGGTCGTTTATGTAGATTTGAGCAAACATTGGATTCCCACCCGGAGGCGGAAGAAGCG
AGTCTATTCGATGACAAATAGTCCCCATCACCTGAAAGTTGTAGAAACCTCGACGCGTTACGCTTTCATCTACTTGCAGAGGATCCGACCGCGACGCCCC
CATGGAAGTAAAGGCAAAAACGTTGTTATAAGCTCGGATAGCTTTCCTGAAAGCAGGATTGTCGAATAGCAATCGGAGCTTCTCTGGGGCTTCACGCCGT
GGCGGCAGCTGAACCTTACcgcccatgcagcagcatttttCCGTTTCCCCCGGGAACTTCCACGC