Description :
From Genome Similarity Track
Location :
Scaffold_566:9- 2496
Sequence
2487 bases(100 bases per row)
CCACAGTGTGCAGTCGTGGTCACCCCCAAGCGCCCACCTCCCCGTTTATTTCGTGGCTGGCCCGCCGTTCGTGCAATCTAGTTCTAATGTAGTACTGTCC
TCCGTGCTCGGTAAGCTCAGGTTCAACACTGGTATCGTTCTCCGCGGCACGGTGATTTTACGTCTATAGCTCTGTGGCTGCGTTCTCCCATGGCTTAGTG
GCACAGCCCATGCTATCGTGCTAGCTTGTGGTGTCGCGGCTGGTCTGTCGTCCGTGTGATTGTTAGGTACCGTAGTATCGTGCTCCCTGGCTTGGTGAGA
TCCGGTTCTACCCTGATAACGTGCTCTAATGCTCGATGACTTCCCGTTTTCGGATTCCCGCCGCTTCATGCCTGGTCCGGCGACCGTACTCCGTGCTCTT
CCGTGGTGCTATGGGAGAGTTGCTGTCCATGCACTCTTACCGCTACGTGCGTACTCTTCCGTAGCCACGCTCACAACGGAAGTTTAAAGTTAAGTGGGTC
GGCTACGATGAGCCTACTTGGGAACCACTGTCAAATTTGTCATGTGGAGGTCTCCTGTTTGACTATCTACGACAGAAGAAGCGCGAAAACCGTCTGCAAA
TGGTGCAAGTTGCAGATGAGGATTAACAGCTATTGCACCAAAAGTTACACCAACTCATCGGACGACACAGGCCGAGTTGAGATGGAATGCTACTGTGTCG
AAACTACATATACTGAATAATTACGAAATGAAGTCCTGAACGATACCTACGGGACGCCCAGTTAAAGGAAGAAAATTAAAAGGTCGGCGATCCGGACTCC
AAGTGAGTTGAACCCGACGGAGATAACTGGGAAGAGCTCAGCGGACTCGACGATTGGGGGCGTGGCGTCGTAGCAGACGTCATCCCTTGGGAACTTGCGG
AAGGAGATGCAACATTCGCAGCCGTGGCAAGAAGTATCATCGCCGAGCTAGCCAACGAAGCTGACGCCGAACCAGATGCCTCAGGGCCCGACTCGGCTGA
AGTGGGTTGAGGCGGATCCGTTCCACTGGGGAGTGGGGTGCCGAACAGAGACATACTCGGAGACGCGCCTCGGAGATTGGGAGAACCCAACCCATCGTCC
GCCGAGTCGTCATCAGACGCACTCTCGTCATCTGAGCCGAGCTCACCGATTGAAGACCCAGTGAAGATATGGATGCCTTGACGATTCAGCCGAGTTGGAG
CACCCGGGGCATAGGCAGGAGGCGCTTGTTCGGCAAGATCGAAGTCTTCTTCAAACGCGTCGTCAACAACCTGAGGATCCATACCGCGCGGAGCGAAACC
AAGAAGTCCACGTTCCGAGCGCGGAAAGCAGGTGTTATACGGGTGTGCCGCCGGGTCAGTTAGCCACCAAGCTGGCCAAGGCTCGGCTAGATCCACATCG
TGAGCACATTGGACCCAGTCTCTCCCGGAGGGAACCCACGAAAGGTTAACGGGAGAGTAATGGGGACGGACGGATCGAAATAAACCTCTGCGTCCACCAG
AGGAGCAGGTTCATCGCCGAGCTTCTGAGTGACCGCCGAGTAAAGCTGATCGTAGACAGCGACAACCAAAGATCGCAGAGTGTCACTACGACGTTTGCAC
TCACGCTTGTACACCAGCCATAGCTCATACACCTCAGCAAGCTGAGCGGGCGTGGCAGCCGGGTTGACGTCAGGATGGAGACCCATCAACACACTTGACT
CGACGATCCAATGACGACGCTCATAGAGAGCTACGAAATAACGGGTCATTTGGCCATCTGTCTGGATAGGCCTCCCCGCCGAGTCCAAGGGACTGTCGCC
ACGAAGCTTCACCCACATATCTCCAAGAACTTGCAACAAAGTTCGAGGTCGGGTCTGAGAAGTCAAACACCGCCGGGATTCCTCCAGTATCGACGGAGAA
AAGAAGAAAGGAAGCTCAGGGAGCATCCGCCGAAGACGCTGACAAGGATGGCTCGGATCGAAAACGGCCATGAAAGCTCGAATGCCGTCAAGAGAACACG
GCGTAGGTGGCACACGACTCTTTCGTCCTACGAGCTCCATCTGCACCCCTCCGCTCAGTGTATCCAATAACGCATTCCAACAACGAGCTGAGCCGAAATG
CATAAATGGCACCTCGCGGAGTTGCGCCATGTGAAGAGTCAAGCGACAATCCTTGGAAACTGCTTGCGAAGCTCGGGTCCGTAAAGTCGCCAGCGGGAGT
GTAAGAGCGCTGGGTAGTGTGACCAAAGCCGGACGTGATGCAGTCGAACTCGGCTGAGGAAGAATCGACACTACCGGGAGCATATTTGGCGAGGGAGCAG
CCGGAATGGATTGAGCAGGAGCCGGATCAGGAGTTGACGGAGGCTGCCGATGCTTGTGGTGCCGGTGCGTCTTGTGGTGCTTCTTGTGTTTCTTGTGCTT
CCTGGGCCGCTTCATCCGGTGACCGGTAGGACTCGACGAAGCACGACGCTTGCGACGCTGCTTCTTCCCCGAAGCCGACGAAGAGGT