Description :
From Genome Similarity Track
Location :
scaffold_1734:9- 2421
Transcript NameFunction/comments
g11658.t1hypothetical protein

Sequence
2412 bases(100 bases per row)
GCCTTCCAGGCCTCCCAGGCGAGTCATCAACCCTAGATGACTCGTGCTGCACGTACGGCTTCAACCGCCCGACGTAGAACGTCGGATGGAGCCTCATGCT
GGACGGTATGTCCAGCCGATACGCGTTGCCGTGCCGTTCAAGTACTGTGAACGGCCCAATGAATCTTGGAGCAAGCTTACTTGCTCCAAAGTCAGACACT
GGAAGTTTAGGCAGGTTTTGAGTAGCTAACAAAACCAATGAACCCCTTTTGAATTCATTCATGTTGCCCCTGCCAACATTATCAGCGTTCAGCTTCTGTC
GATCGACAGAAACTGCGATAGCGTCTTGCACAAACTGTATCACGGCTTGTCTTCGCTGGACAAAGTCTAGCGCGTTCGAGCTGAATCCTTTCAGCTCGTC
GTCTTCGTCCGCAGCAGGCCCTGCCTGCGCGCTATCACTCCCTATGTCTGTGCCGGGCACAGACATCGCGCGTCCGTTCCTACTCGAACAAGACGCTGCA
CACGTCACCGCAGCTGATAGTGTGCTATCAGCGGTATTCTGCGGTTGTTCAGACGCAACCGTAGATCCTTCCCCACTTAAGGAGGGAGCTACCCCGCCGA
GCATGCTCGGCAAACATGGATGCCTCATGGCGTTCACGTAGAACGATGTATGCCCAGTCGAGGCATGCACCGAGTTGTTGATGGCAAACTCTGCCATCGG
CAAGCACTCGCTCCAATGCGGGAACGAGTGAGCGTAGCTCTTCAGCTCGTCACCCAGTACACGGTTGACGCGTTCGGTCTGTCCGTCCGTCTGCGGATAT
TCCGCAGTCGACATTGACAACTGTGAACCAAGATGTATAAACACTTCTTGCCAGAACCGCGGTGTGAAGCGTGGATCACGGTCCAACACAATGTCGAGCG
GCATGCCATGGTGTTTGAACACGATGTCAACAAACAGTCGCGCAGTCTGCGCGGCTGTAACAGTAGCCGGGACGGCAGCAAGATGGACCATCTTGCTGAA
TCGGTCCACAAAGACAACGATGCCCGTCCTCCGCTTGCTGTCAGGCGGAAGACCGAAGACAAAGTCCAAGGACATGGACTGCCAACACTCCGACGGAGTC
GAAAGTGACTGAAGAGGAGCCTGCGAGACCGGCGCAGGTTTCACGCGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCACTTGTACTGGTGGT
GCCAGTAGAAGTCACGCGTGAGAAGAGTGTGTGTCTTCTCACGACCCGGATGCCCTGCCGTAGGGGCATCGTGATACTCGAACATGATCCTCAATCGCAG
ATCATGATCATTCGGAACGACAATGCGGTCCGCATTGTCGTCTACTGCACTGTACAACAGTAGCCCTTCGTGTACACGATACCGATGTACACGATACCGA
AGATAAGGTGCTGCGAGGTACTCCAGCAGCCCCTTCGCGTCTGCATCTCTTGCATACGCGCCCTACACGTCGTCAATCAACGTTGACGACGGCACACTTG
TCCTCACGACGCCAACAGCGTTTACGTCGACCGTCTCCGCATAGTCAGGTCGACGCGATAACGCGTCGGCCACTACGTTGAGTCTTCCGGGTTTGTACTC
GACCCGGAAGTTGTACTCCGCGAAGAAGGACAACCATCTCGCCATACGTTGCGAGATGTGCGGCGACGTAATAGCCGTCCGCAGTGATGCGTGGTCTGTA
TAGACCACGAACGGTCTACCCCCAAGTAGATACACTCGGAACTTTGCGAGTGCATACTTCATGGCAAGGAGCTCCTTGTCATGTACGGGATAGTTACGCT
CAGCTGGCTTCAGCTGACGCGATTGATCGTAGACCACACGATCACGAGGGGCGTGATCGTGTTGCATCAATGCGCATCCGATTGCAAAGTCGGATGCGTC
ACACACTAGGACGATCTTGGTCAGCCACTGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCATCGAATGCCCCTTGGCACTCGGCGGTCCAAAT
CCACTCAGCTTCTTTCTTAAGAAGCTGTGACAGCGGGCGAATCTTGCCCGCGTAGTTCTCCACGTACTTGCACAAGTACGTGGCGAGCTCAAGGAACTGC
CTTAGTTCCTTCACATTAGATGGCGTGGGCCATTCATTGATCACTCTGACCTTCTCTGGGTCAGGGCGCACGCCGTCCTTCCCGACGAGACACCCCAGCA
CGGGTATCTCGCTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTATGCTTCCTCATAAGCTCTAGCAGCTTCCGGAGATGCACCCTGTGCAT
CTCAGCGTCCGTCTTACCATTCACAGCCCGGCTGTGGACGAACACGTCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAATAGATGTGTCACG
CATCTATTGAAC