Description :
From Genome Similarity Track
Location :
Scaffold_971:9- 2232
Transcript NameFunction/comments
g16337.t1hypothetical protein

Sequence
2223 bases(100 bases per row)
GACAGTGGCCACTGCAGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCAAAGTCCCCGCATAG
CGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGATGGTACCGGCACAGACGCCGATA
CATCGAAAAGATGTGATCATTGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTG
ATATCCCTATCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCTGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTG
CGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATCCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAG
ATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAATGTATCTTCGGGGCGACCGAGATACCCG
TACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTTCAAACGTAAAGGAACTGC
GGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATG
GGAATGGACTGCTGACTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCAC
GTGGTGTGTGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTTCTACCAATCGCGTCAGCTGA
AGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATT
CGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGTGGAATACAAC
TTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCACGCAGTTGG
CGTCGTCAGGACGACTACACCCTCGTCGTCCTTGGTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAGTACTTCTCC
ACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGATATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCG
ACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACGACGATGCCCCGACATCGGGACATCCTGGCCG
TGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGGTCGTGCTTGCGAGGTATGCCAGCGCGTG
AAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTACATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAG
ACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTAAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGC
ATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCATGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTC
TTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCATGTTGGTTGACACCATGAAGGGCTACGC
GCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAAT
ACCATGAGGCACCCACGCGTACC