Description :
From Genome Similarity Track
Location :
Scaffold_1306:9- 2173
Transcript NameFunction/comments
Phypl_g13061hypothetical protein

Sequence
2164 bases(100 bases per row)
cccccccaccgCTTCGGTTCCCGCCccttgagcttctggcgGAACACCAGCAACCGTGACCGGTCCGGGAGCCTCTCCGTATGGGTTTCGAACATCTCCC
AGAAGTCACGAGCCTTCTCGACCGTGACGGTGTCCGAGTAAAACATCGGCAGTACCTTGACCGCATTCGAAACCAGGTTCGACAACCCATACGCGCTCTG
CGTGAGCGCTGTGTTCGCCGGGCGTCCTCCACCCGCGGCACTCCATACCGGGCGAGGAGCCAGGCTCATACCGGCTCCGCCACCCGCTCCGGTGACTCCA
GCTGGACCACGGCTCAGACCATACGTCACGGTCGGCTTCCcgctcggcgtcgggcgAGAGACAGCCGTAGTCGCCACACTAGGCAACCTAGCACTAACTC
CACTCTGCGCTCCACGCAGCCAAGAGCTCGGGACACGAAGCGGTtgcgacggcttcgtcaCGGGCACCGCCGAACCGTACCCTTCAGGAGGATAACCGTA
GCCTCCTTGCGGATGACCGTAGTCCCTTCGTGGGTATACGTAgccgccatgtcctccaACTTCTCGCTGGGCACCCCAACTCCATCCAAAGCCGGGCGGT
CCTCTCACCGACTCTCAGATCCAGTGTACTGCCGGATGAACCCACTCGGACTCCTCGTCGGCTTAGCGTCCTCTTCGACGGCGTAAGCCGAGGTCGGCTC
GCTGGCTTAACTGCTTTCGTACACAGCGTCGAACCTCCGTTCGGTCGTGCCGTATCCGTAGTCACTTGGCTGGAACCGTTCCGTTCCCAGTTGTCCGATT
CCGAACGGATCACCACGAATGTCTCGTGATGCATCCGCACCCCAGCCaacctccttcttgacctcgGGCTCCTTCAGGCTGGCGGGCTTGCCTCCAGCCG
GAACCTCTTCCTCTGCatccttgtcctcgtcctcttcttcatcggcCCAGAGATCTCCCATGATCTCATCATGCAGAGTATCACGCCCAgcggacgtcga
cgacctcgccgACGCTTCCGTTCCGGCAGGACCTCTTGCAACCCCACCCGTCGATGGAGAACGCTGCTCCTCTTCACTGGCCGTACTCCCTCGATCCACT
CGTCTCGGGACCGTACGCCTTCTCTCGCCTGACTCCAGACGCTCCACCTCGGACCGTACCTCCACGGTCCGTTCTTCACCAAAACCTTGATcgtctccac
gacgtcctacacctccagcttcaccactTTCACCAACTTCTCCCGTCACAGTCATTTCGACTACACGACCAACAGCTCCACTTCACACCGGTAGTCCAAT
TCAGCACCGCGCCTAGGACTCACCATAAATCCACTGATCCCACTTCAGTGTTCTCCACACTCCACTCCAAGCGTGTCAGTTCACTCAAGACCGTACCGAT
CACACGGGCCCTCTGAAGCACCGAAACTTTCTCCTTTCACTCCCGGTCGTAGCCTCCAACGCTTTTCAGAACGCGGTTTGGGCGAGGATCAAAGCCTCCA
ACTCCAGATCAGACACTCGGTTGTCTTGATCTCCGACTCAAATCAATCAACAGCGAAGCACTaccctgcttctccaccacgtgtCGCGAGTCTGCCAGGA
CGCGGGACGGCTTGCGCTGTATGGGAACGGTCTGTGTCGAAGGGCGGAACGAAATATCACGCTAAATCAGCAAAGTCAAATACAAAGAATGATTCAACTT
GCTGTGCTCTTGGCTAATTCACGACTGACCTCTTACCTAGGCGGCGAACTCGGCTCCGCGGCCGCGCACCCAcacttcgacagctcctcgcgcCTTCGAA
CACGCACTCTTCCTCACCCGGTGGACCTCCGCGTGACGCCCCTCCTGGCCGCCGGTCCTCCGCACTTGAACCTGGATAGCTCGGCCCTTCACGACATCCG
GCCTCCGCATCCTCCTGCTCGCTGGGCCGCCAGATCCGAGAGtggccaacggcagctcagcgagctcgCGACATCAGCGAGGATGCGCAGAGACACCGCA
AATCAGCTCCTTGTTGAGCCACTTGCGAACgggcgtcgagctcatcTTCATACAGTTGGGCCTCCAACAGCTGCTCGCTTGTTGAACCCGCGAAGGCACG
GTTGGGACCGTGCCCAAGTCGGTGACCTCCATTCTCACTCGTGACATCCTTCCCGTCCGAAact