Description :
From Genome Similarity Track
Location :
Scaffold_2721:9- 2156
Transcript NameFunction/comments
Phypl_g15334hypothetical protein

Sequence
2147 bases(100 bases per row)
cccccccaccgCTTCGGTTCCCGCCccttgagcttctggcgGAACACCAGCAACCGTGACCGGTCCGGGAGCCTCTCCGTATGGGTTTCGAACATCTCCC
AGAAGTCACGAGCCTTCTCGACCGTGACGGTGTCCGAGTAAAACATCGGCAGTACCTTGACCGCATTCGAAACCAGGTTCGACAACCCATACGCGCTCTG
CGTGAGCGCTGTGTTCGCCGGGCGTCCTCCACCCGCGGCACTCCATACCGGGCGAGGAGCCAGGCTCATACCGGCTCCGCCACCCGCTCCGGTGACTCCA
GCTGGACCACGGCTCAGACCATACGTCACGGTCGGCTTCCcgctcggcgtcgggcgAGAGACAGCCGTAGTCGCCACACTAGGCAACCTAGCACTAACTC
CACTCTGCGCTCCACGCAGCCAAGAGCTCGGGACACGAAGCGGTtgcgacggcttcgtcaCGGGCACCGCCGAACCGTACCCTTCAGGAGGATAACCGTA
GCCTCCTTGCGGATGACCGTAGTCCCTTCGTGGGTATACGTAgccgccatgtcctccaACTTCTCGCTGGGCACCCCAACTCCATCCAAAGCCGGGCGGT
CCTCTCACCGACTCTCAGATCCAGTGTACTGCCGGATGAACCCACTCGGACTCCTCGTCGGCTTAGCGTCCTCTTCGACGGCGTAAGCCGAGGTCGGCTC
GCTGGCTTAACTGCTTTCGTACACAGCGTCGAACCTCCGTTCGGTCGTGCCGTATCCGTAGTCACTTGGCTGGAACCGTTCCGTTCCCAGTTGTCCGATT
CCGAACGGATCACCACGAATGTCTCGTGATGCATCCGCACCCCAGCCaacctccttcttgacctcgGGCTCCTTCAGGCTGGCGGGCTTGCCTCCAGCCG
GAACCTCTTCCTCTGCatccttgtcctcgtcctcttcttcatcggcCCAGAGATCTCCCATGATCTCATCATGCAGAGTATCACGCCCAgcggacgtcga
cgacctcgccgACGCTTCCGTTCCGGCAGGACCTCTTGCAACCCCACCCGTCGATGGAGAACGCTGCTCCTCTTCACTGGCCGTACTCCCTCGATCCACT
CGTCTCGGGACCGTACGCCTTCTCTCGCCTGACTCCAGACGCTCCACCTCGGACCGTACCTCCACGGTCCGTTCTTCACCAAAACCTTGATcgtctccac
gacgtcctacacctccagcttcaccactTTCACCAACTTCTCCCGTCACAGTCATTTCGACTACACGACCAACAGCTCCACTTCACACCGGTAGTCCAAT
TCAGCACCGCGCCTAGGACTCACCATAAATCCACTGATCCCACTTCAGTGTTCTCCACACTCCACTCCAAGCGTGTCAGTTCACTCAAGACCGTACCGAT
CACACGGGCCCTCTGAAGCACCGAAACTTTCTCCTTTCACTCCCGGTCGTAGCCTCCAACGCTTTTCAGAACGCGGTTTGGGCGAGGATCAAAGCCTCCA
ACTCCAGATCAGACACTCGGTTGTCTTGATCTCCGACTCAAATCAATCAACAGCGAAGCACTaccctgcttctccaccacgtgtCGCGAGTCTGCCAGGA
CGCGGGACGGCTTGCGCTGTATGGGAACGGTCTGTGTCGAAGGGCGGAACGAAATATCACGCTAAATCAGCAAAGTCAAATACAAAGAATGATTCAACTT
GCTGTGCTCTTGGCTAATTCACGACTGACCTCTTACCTAGGCGGCGAACTCGGCTCCGCGGCCGCGCACCCAcacttcgacagctcctcgcgcCTTCGAA
CACGCACTCTTCCTCACCCGGTGGACCTCCGCGTGACGCCCCTCCTGGCCGCCGGTCCTCCGCACTTGAACCTGGATAGCTCGGCCCTTCACGACATCCG
GCCTCCGCATCCTCCTGCTCGCTGGGCCGCCAGATCCGAGAGtggccaacggcagctcagcgagctcgCGACATCAGCGAGGATGCGCAGAGACACCGCA
AATCAGCTCCTTGTTGAGCCACTTGCGAACgggcgtcgagctcatcTTCATACAGTTGGGCCTCCAACAGCTGCTCGCTTGTTGAACCCGCGAAGGCACG
GTTGGGACCGTGCCCAAGTCGGTGACCTCCATTCTCACTCGTGGCAG