Description :
From Genome Similarity Track
Location :
Scaffold_142:9- 2136
Transcript NameFunction/comments
Phyca_LT1534557566ATP-dependent RNA helicase DHX8

Sequence
2127 bases(100 bases per row)
gcaagccacagcgtgctgccaagcgaatgtcatctccggagcggtgggaagtacagcaacttattaactcgggcgtgctatctgttgaagattatcctac
attcgacgaagagcatggattgcttaacactgaagcaacagaggaggacttcgaagttgaactgaacgaggacgaaccggtttttttgcgtggccaaact
caaataagtcgcgaaatctcgcccgtcaaaattgtgaaaaacccggatggatcgatgcagcgtgccgctatgacacagtctaatttagccaaagaacgcc
gtgaactgcgccaaacccaggcgaatcaactgatcgactccattcctaaggatcttaaccgtccttgggaagatccgatgccagatgcaggtgagcgtca
tttcgctcaagagttgcggggtatcaacatgggatcaacgtttgaattgcctgagtggaagcagaagtcagtgggaaagaacctctcttacggtatcgtg
tctaacaagtcgattctagagcagcgtgaaagtcttcctgtcttcaaactcaagcgccaattgatgaaggcaattgctgataaccaggttcttgtggtta
ttggagaaactggctcaggaaaaacaactcagatgacgcagtacatggcagaaatgggattgacttcgactggaattattgggtgtacacagccacgtcg
tgtcgctgcttcatccgtcgcgaaacgtgttgccgaggagtttggctgcgaacttggccaagaagttggttactcgatgcgttttgaggacgtcacaagc
ccggagacagtgatcaaatacatgacagagggtatgctgctacgtgaatatctggctgaccctactctgtcaaagtacagtgctttgatgcttgatgaag
cccacgagcggactatcaacacagatgtgttgttcggattgctgaaagaccttctgcggaagcgcaaagatctgaagattattgtgacctcagcaactct
ggatgccgaaaagttttcacgatatttctttgactgcccgatcttcacaattcccggacgaacgttccccgtcgagatcctatacacaaaggnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtgcactggccccggagctcattatcctaccagtgtatggcgcacttccttc
agaaatgcagtcacgcattttcgaaccagcacctaagggctcacgcaagtgtgtcgtggcgaccaatattgctgaggcatcactgacgattgatggcatt
tattatgttgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnagaacgccttcaactcgaagatcggaatggattctcttgtggttgtgccatgctcacaagcctcagctcgccaacgtgccgggcgtgct
ggacgtactggcccgggcaagtgttaccgattgtacaccgagaatgcttacaagaacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnatttgtatgcgcttggcgcattggatgacgaaggtttgttgactcggttgggaaagaaaatggccgaattcccagtggagccaaagaacgcaaag
gtgctactgacttctgttgtactgggttgtgctgaggaagtgttgaccatagtagcgatgttgtcagtggagtccgtattttttcggccaaaagagaagc
aggcccaggccgaccagaagaaggccaaatttcatcaacctgaaggtgatcacttgaccttgctggcagtctatgaggcttgggcgaactccaagttctc
caacccgtggtgctacgaaaacttcat