Description :
From Genome Similarity Track
Location :
Scaffold_3074:9- 2122
Transcript NameFunction/comments
Phypl_g15597reverse transcriptase

Sequence
2113 bases(100 bases per row)
CGCTGTagtgcttgtccagcgaGCATATCCGCACTCGCGTTCCAGTTCCGGCGTACGTGGAAGAGTTCATGGCGCGGCCAAGCCTGTAATGCGTTCCGAC
CTCGCTGTCGCAACAATTTCAGGCCTGGTGACTTACAGTCCATCTTCTCACGCATCTGCCGGATGACGAGGTTCGAGTCTCCACAGGCGACCAGTCGTGC
GACTTCTAGCCCTTCGAGCAGCGAACACCCCAGAAGCAAACCTCGATACTCCGCCTCGTTGACCGTGAGGTCAGATGCGTAGCCCGACGCAGCTTGGACT
ATCTCCCAACCCGGCAGTTTCCAGACAACCGCGCTGAACGATCCGCCTTCGCGTTTGACATTGGCTGATccgtcgaagctgacgacatgcagctcttcgt
ccgaTCACACCGTTGGGATCGGGATGACTGTGATTCGCGATGGGCGTCTACGTAGAGCGatctcttccagcgccgtgtcgaCGAACGCCCTGCGTGACAC
TCGCTGCCAGCGTTCCCAGGATATCTTCCTCTCCCTTCATGGACTGGAATATATCCAGTCTCCACGGTGAGAGTATCGCGGCCCACTGCGACAGTCGGCC
TTGTAGCCCTTTAGATCGGAAAAGCCACGCCAACGTCGTATGCCGCGTCAGGCCACGGATCGCCCTTCCGGCCAACATCGTGAAGCAGTCGTTCAAGACG
CGCAACAGAGCCAGGACCTCCTTTTCGGCGACGTCATAGTTCAGCTCGTTGGGCTTGAGTGTGCGGCCGGTGAACTTCACTGGCTTGCACACACCGTCAT
GATCTTGCGCGAGTACCGCGGAGATCGCCCAGTCACTGGCGTACACGACGACCACCGGTTCTTGGTCTGGATCGTAGTGCTTCAGCATCGGCGTATTGGC
AatcttggccttcagcgtctcgaagGCACGTAGAGCGTGTATTCACTTCTCCTGGCTGTGAACTTCCGGTCGGGTGGCGTACATTTCGAAGTCAAGCTCC
GTGAGGGAGTACAGTGCAGTCGCGTAGACCGCAAACTCCGCGATGAACCGGTGGTAGTAGTTCAGGCTGCCTAGGAACGATTGCAGACCCTTGAGCGTGC
GCGGGAACTCCAACGCCGCGAGCGAGTCCAGATTCTTCGGTTTCGCTTCAATTCCGGCTTCAGAGACCTTGTGGCCCAGGTAGTCGACTCGAGACATACC
CCACTCACTCTTCTCCACACTGATGGACAGATGCCATTGTTCGCAGACGTCCAGCAGTCGCTCGACCTTCGTGCACAAATCGTCCCATGACGTACCGCCG
ATtaggatgtcgtcgatgtacGATCTCCGACCTAGGACGGAGTGGATCCCTGGGGGTTCCGGTTCTCCCTCATCGAAGACGTTCCGAGTATCGCGGTCGG
GCGACAGACTCACGAATCCGTAGAGCGCGTTGTCGATCAGTCTTTGATAGATCTGCGGCGCGTTGCACAGGCCAAATGACATGCGCAGCCACTCAAAGAG
GCCGCGCGGGGTAATGAACGCGGAGGTGAGCTGGGCTCGAGCCGTCATGGGGACGACCCAGAAACCGCTGGCCATGTCGAGAGAAAAGTACCACAGGTAC
TTGTCCAAAtcctccagcaagtcgttCACGAGCGGCATCGGGTAAACCATCAGTTGCGTCAGTCCGTTCACTAGTCGGTAATCGATGCAGAGTCGTATGT
CAATCCCGTTCTTCTTTACGATCACGACAATTGGTGACACccacggcgacgtggacagTCTGATCATGCCAGCACTGAGCAAGCCCTTGAGCAAGTCAGA
TACCTTTTCCTTAAAGCAGGGCGGGATCTTGCGGACGCGTTGTGCTATGGGCTTCGCGTCGCCCACATCTATATCGCAGACGACTCCCACGGCCGCGGGC
GGCNATAAGCCATTTTCGTCGCCTCCAGATAACCTGTCGTaggcgctcttcttgctgtgcgGCATCCTCGGGTGTGTCCCCGGTCGGCCTTCCCACCTTT
AGATCCCCGATCCGCACTTCTGCCGTCAGCGAGATCTCTGGCAACACCGCCAGCTCTGCTTCCAGTTCTTCCGCGAAGAGGTCCGATCCTTCGTGAATGA
Ggcccgcgtcgtc