Description :
From Genome Similarity Track
Location :
Scaffold_1749:9- 2043
Sequence
2034 bases(100 bases per row)
GCGAGCACTGCAATCTTTCAAGGAAGTCGGAACTATCACAGCAGTTTCATCAAGGACTACGCAATATATGCGGCTGTGNNNNNNNNNNCTGTCTGAATTG
CGAGAAGGGGTTTCGTCGGGATTTCCTGACCTCCGCGCACGGATAACGTTGAGCGGTCTGAAGACGAAAGAGAGGACCAATGGAAAGAGGCTACTATGGC
TTAACTATGTTGAAGGCGATGATCACTAAAACTCCAATGTCAAAACATTTTGAACCGGATCGTATTCCAGAGATTGTGGTCTCTGTCTACAAATGGGCCG
TCAGCGTCCCTGATCCAAGAGTACGATGGCGTGTATTAATCACTTAGTTTAACAGTCGAACCTTGAAGGCGAACGATCTCAACAATTAACGGTGGAAAAG
GATGTGCTGGATTTGCTTTGTATCCTGGACGTGTGTTAAAATATGTTGGTCTCAAGAGAAATTACTGTGCTTACACGAAAATTTACATTGGCATGGTTGA
TGCGTATTGAGGTCTCAATGGGAGATTTGGTATTCGGTCTGCTCTGTTGGAGAACTGGACTATAGAGGTGAATAAATCTTAGCAAGGAGAAGACGCGATC
TCGGAAGAATTGGCAGCCAGTATATCCCCATGTGAGGAGGTCGAAGAGATGTTGCTCGCAATATCTCCACGAAAGGACTACCGGCATACGACAACCATGC
GTCAACCGACAGTAGAGGGGGGTGAGGATGATAGTAGCCAATTGTAAAGGATTGGCAAGGATCAAGAAAAATGAGGCTCATATAGCGCAGTTATATTTTA
ACTTCCAGAATCAACGATGCTGTCAGCGGAATCCAGGTACGCGGCCGATCTGACGGTAAAAAAGAATCTGGATATCTACCTCTTACTTCACGGTCTAAAC
CGGGGAGGATTATTATATGCGGCGAATCCAACTTAGTGATCTGGCAGATGCGAGGTGAGACCGAATGCAAAGAATCAGGCTTTCATCCATTTCGACAAAG
GACGCCAGAAACACTGCGATCTTGGTCGATCCATGAGTTCCTGTAAACGAAGCGGGGCTGGAACTAAAGTGCCCATCGGCTAGCCAGTGCTGAGTTACAA
AGGGAAAAGGGCTGTCATTACAACAGACGAAGATTTCCAATACCTAGTTACTATGAATCGTTTAGACGAATTGTTGAAGACAAGACAGGCCGATCCGGTC
GATAGGATTACTGCTATTGCGAGTTAGGTGCAGAGGAGGCGTCATCCGCCTAAAATTTTACAGGAAGAATTGGTGCAGAGGATCAAAAGCGAGCAAATTC
GTCAAGCCTAAGATGAAGAACGTTGGGTCGCTAACCTGAAGAAGTATCTATGGGTGATGTATACAACGTGAGTTCAGAAAAAGAGAAGACGTGCGCCACG
ATCACGCCAGATTATGAGATGGATGAGAGCGATCTGCTGTTTTCCTGCTTGGTCGTAAAGAGAAATTTGAGGATGGCGACGGGTTGGTTTGTCTGGTAAT
ACCGTAGAAGTTAGAACAAGACTTCTTGCAAAATTACCGCACCTTTCTAGAGGGAGACCACAAAGGGAATGGAGGACTTACCATCGGATCAGATTGCTAT
TCCACTAGAGAGGATTACATCGCAGCGTAAAACTCTATTTGGGCGAATGCACGGACTGTGGACATGAAAGGAGTGTTCGACGATCCACGGAAAGTCGCCT
GGTTATTTACAAGCGAGCTAACCTTTCCAGACAATTGCTATGAACCATATTCCATCACTGCCTTAGTCATTCAAGGGAATACAAGTCTACTCAAATTTTC
GAAAACTATGGAGAATGTGTGTTGCGACGTTTCGGAGCGAGTAAAGCCATAAGACATGATCGTGAACCAGGAATCATGACCAATTGATTTCGTGCGTTTA
ACGATTGTGGGAATGAAGAACGGGCTACAATGGTATATCGACAACAGGCGAACAGCAGAGCGTATGATGCAAACACTGACATGTTCACACAATATGTTCG
TCACTTATGTCAACCAAAAGGACTGGGACGAGTA