Description :
From Genome Similarity Track
Location :
Scaffold_155:9- 2003
Sequence
1994 bases(100 bases per row)
GGTGGCCCTACAGAGCTGTATACGGCGCGTAGTGCTGCATGGGTCAAAGGTACTCGCGGTAAGTATGTGGGCGACATAGCTCACGCCGTTGTTGAAGTGG
TACGACTAGCACAATCATGGCGGACCCAAAACAAGCTCGTGGAAGAACTGACTGATACAAAGTCAAGTGATTCGAGTAAGTACGGTGTGCATAGAACCTA
AATTAATCAGTATTGGGTTCTCGTTGCCCCATTCAAGCGAGCGACATCGGACGACTTGAGAGTAGGAAAACTAATCTGTGGTACGAACCGTCCGCACGCC
CGCGGGACAGATCAAAGCTTGATATTTCAAGCTGCGAAGCGCCACCGCATCCACAGTGCCGCAGCAAGGGTAGTGTTGTTTTTTGGAGTTGACTTCAACG
ACATAATAGCAAATGAGAAACGCAAATAGATTGTGAGCGCACCCCGCGATACTTAGTCTCTTGGCACAGGAAGGTTGGTTGGAGCATGTTAAGCGAGCAC
TGCCAGCGCGTTCTGGTCGTGGGCGAGCATACTCGACAAGATCGAACAGATCGACGTTCACTGGATCGTGAAATTCGTGGGTAAGTCAGCGCCGGTTGAA
AGTCCCAGAAGCAGGTGGGTATCAAACTTCAGGACAGTTTCACGTACAATATCGATGTGGGCGTCAGTGACAGGAAACTCATCGTTTACGCGTTGCTCTA
ACCGGTCCTGGCGGAACCGTAGTGCCGGAGACAGTCGAACCAGCACGATGTTCTGTACTCCGGGGTAGTGGCGCCAAATTATTGCTTTGCGATTCAGCCC
AGGGCACCCGACACTGACGCCGATCTCCACCTTCACCGTGTCAAATTCATCCCAATTCAGCCCACCTGGTAGAACTGCACCAACAACGTTTGTATTCGGT
CCGAAGCTGCAATCCGGCTCCCATAGCCGTTCGCCCGCCACACCAACTGGAGGCTCGTCAACAGTAGATACGTGCCCATGGCAGTCCCCGTCCCGACAAG
CATCGCTGTATTGAATCGAGAAACGACCCTCTCATGAACTCTGCCGGGAAACTCCACGATCCAAATTGTCCCGTCTCGCCACTCCATGAACCGTGAGTTG
AGTGCTTGTCGTTCAGATCTGACGTAGCGGTGCCAGCCTCCAGTGAAGCTGTGTATAGCTCCACTTCGGCGGGGTGGTCAAGGCCATCGTCGCGGAGAAG
TAAGGTCTTGACTTCGTCCCAGCCCAGGAGCCTGATGGCATTGTTGATCCTGCATGCTTCTCGCTGAGAAAGTGTTCGCCACACTTTTTTTTCCAAAAAA
AGTTAAGGATTGAGTTATTGTGCTTTGCACGAACTTTGGCATGCGATTAAGGGCTCTAAACCAACGAGCAAATCCTTCCCGGTGATCATATCTCGCAGCC
TAACTCTAAGTTAAAGTTAAGCTAATCAACCGCCAGTACCAGGCACAACGCAGAGCAAGAACGGAGCGGTTGCCACTGCAAGAATAAATCGGTTGTCGCT
GCAAGAAAGCAAACTGATAAGGTCCCCGATAGAATGGCGCCAACTCCTTGCATAATACAGTAAGCACCGATTTCGGCGGGGACGTTTTCTTTCGCTCTCT
TCGTCGTGGCCTTGCGCGTTAAACCAAGCTCGAATTTCAGAGCACGGCATATAGTAGCAGTAGAAAATTTCTACTAGAAATGTTTGGTAGTGCAGGAAAC
GCTGACTTTAAAGCTGCTTGCAGATCCTCGATATAAAAACAGGGATGTTCTTCAATGTAGACGTAGTTTAGTACGATAGATCGCCAACGCATGTCAATCA
TCGACTAGAAAGCAATCAGACAAAGCGAGCGAGTTAGAATTAGAATGTCAGCGCCGTAGTATTGTCGGATTTACTCCAGCCATTCAACGAAAGTGAGCAG
AACTCAACGTTAACTCGTTGTCTTAGCAGCTATTCTATCTTAAATCGACGAATTAGCCTCCTAACTCAATGATGGGCTAATCACCGTGATTTGC