Description :
From Genome Similarity Track
Location :
Scaffold_2384:9- 1985
Transcript NameFunction/comments
Phyag_g12415putative polyprotein

Sequence
1976 bases(100 bases per row)
GTCTACAACGGCCCGGAACCGATGGACTTGTCTGCTGTGTCGGCACAAGCAACCAGGAACAAGCatccaagctcaagcgtGAAGTGTTTCCGCTGTGGCA
AGATGGACCACATGGCGAGGGATTGTCGTGTGCGGATTGACAAACGGTCGACTCCGCAGCGCTATCGCCCAACATCGTCGGGTATTAGATACCCTCGAGG
GCGAAGCGAAGAAACAAAAAACGACAACGACCAGTAGGGGAGGGCCTCCCTACTGGCCAAGTGACGAGTTCTGTGATGACGGTGGAGTCTCAGAACTTTG
GCCACGACGTGCAAGTTGCACAAGTGAAGTccaccaagatgaaggatAGTGTCGGCCGCGGTTCCAAGCTGATCATTTTGAATGTGAAGATGGATCGATC
CTCGGATCCTTTGCGCGCGCTTGTTGACACTAGCGCTACGAGCAATTTTGTTCAAGAGCGAACTCTATTCAGAAGCAAAAGTGTTGCTCCTGATGTGAGA
GTGGTTGGAAGAATGATCGTTCGTTTTGCTGATGGGTCAGCAAGCGAACTAGCGAAGCGAGTTGTTTCACTACGACTCAAGGGTGAAGTTTtccgaggag
aagatgagTACACTCTTCTAGGCCTCGATGACAAGTATGATATTATACTTGGGATGCCGTGGCTATTGCGATATAAGCCAAAGATTGATTGGGAACGGCG
TCTAATCAGTGTTCAAGGATCGAACCCAGTGCAATGGGAAGCTGCGGATGAGGAACAAGTATTGTGGACAACCACTTCGGTTGAAGAAATCGCGGATTTC
TCTGGTGATCATGTGGCGAGCGATGGCCCCACTCGACCCCAGAGCGAGTCTGTCAAGtccagcgatgaagagcgcGTTTCAAGTCAAGTCAAGATGCTTC
AACCGAAGCTGGAAGAAATCTCGATGAGTGAGAGTGTTCAACTCATTTGTCGAGATCCGTCAAGCGACAACGGTTTAGTTGCGACACATACCCCTGAACA
AGGTATGCATGCACTGACCACCCTCGTTGACGAAGGTTGCATCAAGCGCGATGATGCTTCGGGCGAACGGTATGTCCAATCAATGGCATACGATTCATTG
GGGAAAGCACAAGGTGTACACAAGTTGAAAGTCCAAGATCCCCCGTGTTCGCTGTCAAGAGTGCTCTCTCTGGAAGAgatgagcgagaagaagtacCTCC
GTGATCTCAAAGATGGTGAGATTACGCAAGTGTGCATGATCGTTGCTGAGGCCGATCATGAACAAATCAACACGTCGTCAAATATGGACTTCGACGTGCT
AGAAGAAAAGACGCGAATTGAGAGATACGAAGCTCAATCGTGGGAAGCGCTCAAGGAAAACCCAGCGTACAAGCTTGCGCTGGAATTTAAAGATATTTTC
CCAGATACGGTACCGGAAGAACTTCCACCCGATCGTGGAGTTCATCACGAAATTGACTTGACTCCGGGTACCAAGTATTGTGTGACAAGGCAGTGGCCTT
TGCCGAAGGAGCACGTCAAAACTATTGACGAGTTCTTTGAGAAGCGTCGCAAGGCTGGACATGCGCGGGAGAGCAAGTCTCCGCACTGCAGCCCGACCTT
CTGCGTGAAGAAAGCAACGGGTGGTTGGCGTATTGTTCATGCTTTTAACAAACTGAACGATGCCACCATCCCTGCTCAAACACCAGTTCCTCGCAAGGAT
ATGATCCTTGACGGGATGGTGAACAGCACAGTCTTTAGCACTCTGGATTTGATGGATGGGTTCTATCAGATTCGAATGCGAGATAAGGACGCCCCCTTGA
CGGCTGTAAGCATGCCAAGTGGTATGCTGTGGGAATGGCTTGTGATGCCACAAGGACTAAAGAATGTGCCTGCAACTTTTAACCGCATGGTGACGAACAT
TCTCCGTCCTTTGAGAGACTTCGCACCAAGCTATTTCGACGACATTTTTGTCCACAGCAAATCCTCGGGCGACCGA