Description :
From Genome Similarity Track
Location :
Scaffold_1401:9- 1679
Sequence
1670 bases(100 bases per row)
GTACTAGTTGCTGCAGATACACGTGGTTAGTCACACGTGCTAATGATGATGGCTCCCAAGTGAGCTTATCTGTTCAGGGGATTCGGACGGTGGGTCCGAC
TCGAAGAAGACACTAGGTCGTCCGAGTCTACAGGGAGCGCCCGCATACGACCCTACAAATAGGACTTGAGTGGGTAGTCAGACTCATGATCACTACCGGA
GTCTGTTTAGTTCGGAGGATGAGCATGCTGACTCAACCCCCCCCCCCCGCGCCTGTTACTGCACATTCTCCTTATCGAGAATTCGGTGATGACTTGAACC
GTCGTGATGACGATTCTAGTGGTACCAAGGCTTCCGTTGGTACCACGAAGGAGGCGCTAGACGGCAATGTGCTGCGTCTAGCCCCTGAACACAAGCCTTG
GGTGTTAACAGAAAGGATTGTGAATGACTTGTCAGGCGAGACAAGTCTCCATCATCGAATTCCATTAATCGATGCGAGGAAGTTACACGGACTCGACATC
AGCACTAGTGACTTTCGCGCTGAAAAAGACTTCTATCTGGATGTTTTTCTGAAGCATTGATGGTCTAGTGGCAACACTAAGCGAGGCAAAAGCTCGTTGC
TGAAGGCGTGGAACGCCTTTATACTTAATGTGCAGCACATTGGGCGCGAAGCTTGGCTTTGGAAACTTGATACAGCTCGTGTTAGGTTTAAGAAACGAAT
CTTGACTGGTGAAAAAGTCAGGTTGCACAAGCTGTAGCGTGAGGCAGGAATTCCATGCCTCACGCGGGGCACCCGTGTCCGTGTTTTATCGACAACACTC
AACGAATCAGCAGGGAGGTGTACTCCCTTTCTTCGCCATGGGGTAGGGCGCACGTCTCTTCTGAGATGCGCGATGCGATTGCTAATCTGCAATCGCTCTA
CCAGCGCCATGTGTGCGTGTTTTTCGATGGTCCTTCTGAGCCATCGGATGTGTCTCGTCGTACTGGTGAACGAGACCCTCAATGTCAATCATCATCTAGG
CGCGAGGCACCCAGCTGTCGTGTGACGGTGGATAGCCGCGCCAGCGAACAAGATAACTCGTTCGCTGCCCCTTCACCTCACTGTGGTTTAAGATACGCTC
CACGTGAAAGCGTTGACCACCTTGCGAATTTGCCAATGGCTGTGGTGGGGGAGAAAATACCAACTCCGAATCACTTGGAGTTGCAGGCAGAGGTTTGGTC
GTCTCCAGCAACGCGTGCACGATCTGTGTGATTGCTCCGAACAAGAGAGGCAGGAGCGTCTCTCTTTGGAGGCGTGGGTGCAACGCGTCCGCCTTTATCG
ATCGGACGACCGATCGGAGTTCGCGTTCTACCAATTGGAGAATGAGCGAGCGCGTCAAGACTTTCGGGACGAAGTGGCTGACATTCGTCGCCAGCATGTC
GCTCTACAGAGCCAGATTGAGAAACTGGCTCGGTACGAAAAGATCTCTTGGAGGTTCTTGAACGTGGCGGTTGGATACGCCCGAGGAAGAGACCTCGTGG
TGATGGTACGGGCGGAGACGACCGACATAAACCGTAGGATGCGTACGCATCCTGCGAGGCAACTCGATCGTGTACGCATTGTCTTTGCGACGTAGTCCAC
GGAACAGGCCAATGTACTTCGGTAGTAGTCTGCTTCTACTCATATTAGTTATTACGTGCTTAGGTATATT