Description :
From Genome Similarity Track
Location :
Scaffold_1850:9- 1640
Sequence
1631 bases(100 bases per row)
GTAACCCTCAACAACCGTCTGAGCCGTCCGGGATAAGCTATATTTCGCGATAACATAACCTAAAAAGAGATCGATCCGAATATGTAGCTTGGTATTATCC
TTGCATGACTTGGGCAGCGACGGATGTGGTCAATGGCGACAATCTAGAAAGGGTAGGTTGCTTTTAGATTGCCGAACGACTTTCCGTGTATCGTCGGACA
CCCTTTCCCTGTCTCGCAGTCCTTACATTCGCCCACATAACGTTGTACCCTGAGATACAACCCTCTCCAGTGGAATCGAGATCTGATCCGCTGGTAGGTC
ATGCCGCTTCCCTGGTGACCTCCCTCTAGACTGGAGTGGTAATGGTGCAAGAAGGCTTGCTGTAATATATCAGGTTTTACTAGACGCACCAACCCGTCAT
GATCCTTTGGATTCTTTTTCGCGAATGGACAGAAGAATAGCAGATCACTCTCATCAATCTCATAATCTGGTGCGATTTTGGCACACGTATTCACTTATAC
TGAACCCAGGTTAGATACATCGCCCACTAGATGCTACTTCAAGTTGACCTTCGAATGTTCTTTATCTTGGGCTTGACAAATTTGCTCGCTTCTGATCCTC
CGCACCAATTCTTCCTGTAAGNNNNNNNNNNNCGGATGACGTCTCCTCTACACCGGCCTTGTAATTGCAGTAATATTACCGACTCGATATGCGTATTTTG
TCATCATCAAATCGTCCAAATGATTCAGAGTAGCCATATCTTGGCGATCTTCGTCTGTTGTAATAACAGTCCCTTGACCCTTTTGGAATGCAGCACTGGA
TAGCCGATCTGCACTTTGATTTCAATCTTTCATCATGTGTCACTCATGGATCGGCCAAGATCGCAATTTCTCTANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCCACCTGTCGAATCATTAATTTGGAGCCGCCGTATAGAATGGCCCGCCCTCGGTCCAGGTCAGCAAGCAAATCG
AAACATAACAGCAAGCCATTATACTTAACTTCATTTACCGCCAGATCGGAAGTATACCTGGATTTCGACGACAAGATCATCCGTTCTGAGAGATTCCATA
TTACTGCGCTGTATGCACCTCCTTTTTTCTTGATCCTTGCCGATCCATCGAAAAATTGGCCCCTGCTCCCTTTTACTGTCAGAAAAGGCAGAAGGGGACA
TTTCCAACATCTCTTTAATTCCTCGCGCGGGGTTATTCATGCTGCCAATGCTCCCAATTCTCATCAGCTCTCGTTTTGCACTTCGTCATATCCATATTCC
AGTTCGATAACTAAGCATTCCAGCGTCCTAGGCTTCCGTTGATACCTCGATATCGCATCAACCATGGAAATGTTGAGCGTCGTGTCAGAACCATGATCTC
TATTAAGACCAACATAGTATAACACACATTCATTATATGAAGCAATTCCAACACTAACTTCTCAACCTTCCAATAGTTGAGTTTGTTCGCCTTCAACGTT
CGACTTGTGAAAGTAANNNNNNNNNNACACGAAATCCTACTCTTGGATCAGGGCTGCTGAGACTACCCACTTGCAGGCATAGACCACAATCACTGGAGGA
CGATCTGAGTCAAAATGTCTTAGAGTCGGAG