Description :
From Genome Similarity Track
Location :
Scaffold_3411:9- 1542
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3411-snap-gene-0.2Aspartyl protease family A01B

Sequence
1533 bases(100 bases per row)
TCATCATCGTCGTCGTCCGAATCAATGTCATCCGAACGAAGCGGTTGCTTTCCGCGGGACTTTTTCGAGCGCACATGCGGATCGAGTTCCTCCTCTTCAT
CGTCAACGTCATCTTCGTTTTCTTTCACTCGACTCCAGTTGTGGTCTTTCTTGTTCTTCTTAAACTTGATTGACGCTGCTACAACGAGAAGAAACACCGC
AACAAGAACCGTGCCCACGATTGTAAGCACCATCGGGTGGTCATCTTCGTTCGCAGTGTTCGCATGATTCAAATGTGTAGTGCCAGTCGTTGCTGTGCTC
TCAGGGACCGGCGTCGAGACCGGTGCTGGCTCAGAAGAGCTTTTCGATGATTCACCATTAAAGTCAACAACTGCTGCTGCAACTGGAGTTGACGATGGCG
ATGGCGTGGCAGTTGGTTCCAAGGTTGGCTTTGAAGTTGGCGTGGTTGCTGGTTCGGCAGTCGGTACAACAGTTGGCTCCAGTGTTGGCGTCATGGTTGG
TTTGGGTGTTAGTATCACTGATGGTCCAAGACTCGGCGTCGTGGATGGCACAGGTGTCAGTGTTGGAGCTGGCGTTAGGACATGCTTTGTAGTTACATTT
GGGGTTGTGGCTTCGGATGTATTTGTGTTGCTCGATGTAACAACCCCGGGAGCTGGCTTATCACGAGGTGTACCCGAGGGGGCCGTGGCATTTGAGTACG
CACAATCCGCATCCACAAAACCCACGCGTTTGTTTTCACTGTCGAAGATCACATCTCGATCCATCATGATGTTTGCACCGATCACTGCACACATTGCATA
CCGACACAACGAATAATTCATCAGTATCATCTCAGCAAGCGACAATGTACACATAAATCCACAAGAATCCACACACCACATACCTCCTCCAGAAAACTCC
GTCAAAAACACACTCGCGCAGTAGTGGCCATCACTTTCTTGGATCAAGTACTGGTCTGGCGTCACCTGGAGCACAAGATCGCCACCATCTTCTGCTTCCA
ACACAATCTGGATGTTCGGAAGCGCATTGAGGTCTTCATCCGTGTACCCTTTACAACCAGCACCCGACGCTTGATACTTTAGACCTGTAGCCTTCTCAAA
TGCAGCTTCAAAAGCAGCCTTCATCGAGCTCGGCAAGTACGAATCCGTTGTGCCGCTGTCGACGATAAAGTGTCCCTGGGAGTAGCTCTTAGCTGGAGCG
CCGATGGCTTCGTCGCCGATCTTGACATCTCTCAAGATAACATTGTAAAAGTTGCTGTTCGAAAACAACACAACAAGGCGCAGAGTGAGTGAGGGTCTTG
TTTCGCAGATCATGATTCATGACAATTCATCCACAACTTATTCAGTCAGTAACAACAACACACAAACCTGCGGGTTGGGTCAGGACCGAGTTTTGCGTAC
GCTATCTCTCCCTTGTGACGCACAGTGTCCGGAACGCCGATTGACATGGAGCCTCCGTCGAAGCCAAAGCACAGCGAGAACAGTTTGCTGGGGATCTTCT
TTTCGTTGTACAGTTTCGCAACCAGGTTGTCAT