Description :
From Genome Similarity Track
Location :
Scaffold_1685:9- 1470
Transcript NameFunction/comments
Phyke_g12063Amino Acid/Auxin Permease (AAAP) Family

Sequence
1461 bases(100 bases per row)
TCGAGGACCTCAAGATGGCCTTCAAcgtcttctgctgcgtctaTGGCGTCGGTACACTTGGTATGCCCGGCAACTTCTCCCGGGCCGGACCTGTATTGGC
TGTCATCGCCATGGCCTTCATGGCATTCGCCAACGTCTACGCTTCGGTGGCCATCTGTCGAGTCATGCTACTAGCTCCTAAGTCTGTTAAGACGTATGGT
GATCTCGGTCAGTGGTGCATGGGCAAGTGGGGTCACTGGCTCGCTGTTGTCTCTCAGATGGCGTCGTGTCTTCTGGTGCCATGTGTGTTTTTGGTCCTGG
GTGGATCTCTTCTTGACGGTCTCTTCCCCGATGCTTTCAGCGACTCTGTGTGGATTATCTTCATGGCACTCATGTGTCTACCGGTGTGCCTCATCCCGAC
TTTGAAAGAAGGAGCGGGAGCGGCTTTCGCGGGATGCATGGGCACAGTTATTGCTGATGTCATTGGTGTGGCCGTGGTGATGTATGGTATGCGCGGTCAT
CCTTCTGTCCCGGCACCCGATCTCAAGTTTTCTCAAGTGGCTGGTGTATTTGGCAACCTGTCGCTCGCTTACGGTGCGGGAGTCGTTATCCCTGCATTGC
AACGACAGCACAGTGAACCTCGACGCATGCCTCGTGTGATCGGATTTACGATCACACTCATTTCATGTCTGTTCTTGATATTGGCCAGTACGGCATATTC
GGCTGTCGGTTGCCAAATCACAGGCAACCTACTCTTCTCCATCTACCCAGACGCAACAAGTGGCTTGACCACACTCGGCTTTGCTTCGGACTGGGGTGCT
GTGGTGTTGGCATATCTGTTCATGCAGCTGCACATCACGATCGCTTTCTCGGTTCTGTTGAACCCCGTGTTCTACCTGTCGGAACGTCTTGCTCTTGGGA
TGCACAAGAAAAAACAAAGTGATATTGAAGATGGACTCACTTATGCTGACATGGACACGCCCGCCAAGGCATCTGTGGTAAACGAATCCGTGAACCAGTC
CGAGCGCCCTTCCCGGATGTCCTATGTATCAGTCGCTGATGCTGAGAACCCACACTATGGTGATGctgaggctgaagctgctgagtACCGCGGTGCGAAT
GCCATCAAGTACGTCTTGATGCGTATTGCTATCATCGTGGTGCTAGTGGTTCTGTCCATAGTCTTGAAGGACCATTTCTCGGACCTGTCGGACTTTGTGG
GTGCCTCGTGCATTTCACTCAACAGTATCATCTTGCCGATCGTATTCTTGCTGAAGAAATGCTGGGGTTCACTTCCCATGTACGAGAAGATacctgctgt
ggtggtggtggttgtgTGCTGCTTCCTGGGCTGCTACGTGACGTACACGTCCGGCAAGACATTGTTTTCCCCAACGGACTCGGACGTGTCATTTCCATAC
TGTGACCCTGAGTACGAGACCACGGTGTATTACAACTATACCGCTGTGCACGGCCTGTAAG