Description :
From Genome Similarity Track
Location :
Scaffold_1727:9- 1465
Sequence
1456 bases(100 bases per row)
TGCGGAACTCCTTCGCCTTCAGGTCGCCCACGAGCGACTGCGCGCGGACTTGGCGGAAGAGAAGGCTCTTCGCGTGCAGCTTGCATCGACGCTGGACTCG
GTCCAACGGTCGAATAACCAGCTCCGTTCGGAGCTGGACGCACTTGTTCGAGACTACAAGGTTCTGCTTGGGAACCTTGAGCGCGCTGGGATTCAGATCC
CTCGCAAGCGTCCGCGTACCGGTGGTATGGGCTGCGTGGAAGCTCCAGCGTGTACGCGTTGTCCGTGCGGCGCAACACGCGAAACGGACCAACGTACTTT
GGTAGTAGCTTAGTACTACCAACAACAACGTTGGTGATTGCATGTGGCGGTAGGGTAGTCGTTGATAACAACACTAAGTCACCTACATTGAATGAAAGTG
TTTCCTCTTCCAGTTCTGTCCGCATTTTGCTTCTGTCGTTCGACCGCGTGGGCGATCGAGTTCTGCACAAAGCGGATGACCGCTTCGCGTGTCAGCAGGA
AGTCCCCTGCTGACTCGACTTGTCTGTCCGAGGTGCGTGTTTGTCGCACCGCGGAGACGTCCATGTCTTCGTCGACGAGAGTTTCGTCATTCTCGTCGTC
GACATCTGATGAGCGAGTGGCGTTCGGAGGCGTGCCCGAGCGAGTCCcTTCCCCCcTTAGAGAAAGTTAGAGAAAGGTCACTTTCCAAGAGACTGGGAAT
ACGTGGGTGGCGAAGACCATTCACGTAGAACGGCGCGTGCAGCGTTGACGTGTGCACAGAGTTGTTGATGGCGAATTCCACCATTGGCAGAAaCTCGCTC
CAACTCGAGAACGAGTGATCATATCCGCGGAGGATCTCCTCGATCACGCGGTTAGCACGTTCGGTCTGACCATCTGTCTCCGGATGGTCAGTGGTCGACA
TCTTGACTTGTGTTCCGAGGAGGTGGAACACGGTGCGCCAAAACTCGGCGGTAAAACGCGGATCACGGTCAGACGCGAGTTCCCGTGGCAGGCCGTGGAG
ATGGAAGACCGTGTCCACGAAGATGCGCGCACAGCCTTCGGCTGTGATCGACTCTGGGACTGCAGCAAGATGAACCATCTTGCTGAAGCGACCCACAAAC
ACAAGAATGCCATCATTCTTGTTTGGATCTTCGGGAAATCCGAACATGAAGTCCATTGACACGGAATCCCAGCACTCTGTCGGGACCGGCAGAGATTGGA
GCGGAGCGCGGAGTGAAGGACCTGGCTTCACCCGCTGGCACACCTCGCAAGCACGAACGTACTTGCGTACGAACTTATATTGGTGTGGCCAATAGAAGTC
GCGACTCAACGTGAGATATGTCTTCTCACGTCCACGATGACCGCTGACCGGCGCATCGTGGTATTCGTACATGATCCGCAGGCGCAGATCATGTGTTGCT
GGGATGATGACGCGCGACGTGTCGTCGGGCGTGGCGCTGTAATACAGCAGGCCATT