Description :
From Genome Similarity Track
Location :
Scaffold_286:9- 1427
Sequence
1418 bases(100 bases per row)
GTAGTCACATAGAACGGGGTATGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAACTCACTCCACTCTCCGAAAGACG
TCGCATAGCTGCGCAACACGTCTTCAGGACACGATTCACTCGTTCAGTTTGACCGTCTGTCTCTGGGTGTGCTGCTGTTGACATGGATAGTTTCGTATCC
AAAATGCCAAACAGAGTACGCCAGAATCTGGACGTAAACCGAGTGTCTCGGTCGGACACGATCTCCCAAGGCAGACCATGTAGACGGAACACCACGTCTA
CAAAGACTTTCGCAGTCATCTCTGCCGAGATCTTGTCAGAGACCGGAGTAAGATGCACCATCTTACTAAATCGGTCCACAAACACCAGGATGCCATTCCT
GCCGTGTTTGTCCCTTGGAAGTCCGAATATGAAATCCATACTCACGGACTTCCAGCTGTCAGTTGGCACTGCCAATGAACGAAGTGGGGCTTGTGTGGAG
CCAGAGGGCTTCACACGCTGGCAGATTTCGCAAGTCCTCACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAATAATCCCGGGAAAGATTGAGAA
ACGTTTTCTCACGTCCGAGATGACCACCTGAGGGACTGTCATGATACTCATACAAGAGTCGATGACGCAGGCCCTCGTCGTTGGGAACAACAACCCTTGC
TGTATCCCCATCTTCAACCGCATAGTACAACAACCCATTGTGTACTTGGAAGCGGTGAACACGCGATCTTGTTCGAGCAGGCAAGCTCTGCAGTGCTTTG
TCCGAAGGATCTTTGAAGTACTTCAACAAGTCCTGACATGTGTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGTCGTCGTGGCTTGAACTG
CGATCGCTTGAACATCTTCGCAAAGTCGACATTCTTCGTCCAGATTGTCACTCTTGGACTTCGGATCGTAATCCGGACGTCTTGACAATGCGTCGGCTAA
GATGTTCGTCTTGCCTGGCTTGTAGTGTACAACAAAGTTGTACTCTGCAAAGAAGGAAAGCCATCTCGCCATTCTTTGCGACAAGTGAGGAGTCTTTACC
GCTGTCCGCAGTGATGCGTGATCAGTGTAAATAGCAAAGCGCTCCTCGCCAAGCAGATAGACACGGAACTTGACAAGAGCATACTTCATCGCCAGAAGTT
CCTTGTCATGAACTGGGTAGTTCCGTTCTGCGGGTCTGAGTTGTCGTGACTGATACGAAACAACTCGCTCTCGACCCTCATCATCGTGTTGCATCAATGC
ACAACCGATGGCATAGTCGCTCGCATCACAGACGACATGGAACGGCTTGTCGTGGTCCGGTAAAGCCAACACAGGAGCTTCACGAAGACTCCTCTTGACT
TCTTCGAACGCCGTTTGA