Description :
From Genome Similarity Track
Location :
contig_39:9- 1255
Transcript NameFunction/comments
g8480.t1hypothetical protein

Sequence
1246 bases(100 bases per row)
CCCCTCCCCAGGCCCCTACTGGGGCCCCCGCGGATCACGATGCGAATCGTGATCCGCCGGATGAAGGTCCGACGGTGAAAACCGAAGGACTTTCATCCAC
AACTACTCCTCCAACCTCTCGATCGGCACCGAAGAAGAAGTCGAAGACATCGCGCATGAAGATGAAAGCGCCAGAATCGGATGCTGAGGACCAGACGGAC
AATGAAGGCTGGACAGAAGAGCAGTTGGAATCTGTTTTTCTATCGAAAAGACCTGTACAAGTTCCTGACCGAAGATCGAACGATGAAGATCATGCAGCTG
AAGCTGATCGGCGATCTCCAAGGTCCGGTGAAGGCACCCAGAGAAGTGTCGAACAAGTTGGACGCAGTCAGAGCCCTGATGCGAATGCTCAAGGAGGCTG
GAATAGTTCTTGGTGCGTTCGATGCAAACGAATTGTTTGATCTAGAACTGGAAACGATCAGAGAGGCAACTCTAACTCTCTTCGCCAAACTGACGCATAT
GGTGGGCAGCGTAGTCCCGATCCAGCAAGCAAGATTGCCTACGGTCCGCAGCCAGACGGGATCTTCCCAATACGCGTCTGCCACGTCAGAGGCGGGGTCA
GATAGCTCGGTTGAACTGCAACGAATGACACTCGGGCCAGTTGGAGTAGCCATGTTACGATCACACAAAGATAGATCGGAAGTCAAGACATCAGCTGACC
CAAGATCTGGCCAAGCCCAAGCAACACCCGATCGCATGCAAACCTTTTTCAATGCAGCGATGGAGCGTTTTCTGAAGGGGCAACAGACGCCGGCAGTCCC
GCAGACGGCCGATCGCCCTGTTACCTATCGGACCAAATCGCCCGGAGCTCAAGACGTCGAGATGGAATCAGTGGAATCAAACCACGTGGTCCACTCTCAT
CCAAGCGAATACGATCCGGATGATCTGAGCGTAGGAACTCCCAGGTCGCGTCCGCCGAAAATTCTGGTGGCGGATCGCTCTCTGCTACTCGAATCAAAGT
GTCGGCGATCTCTGAACTAAAGGAGTTTTCCGGAAAGGACAATGACGAGGACCGCGCCAGGGGTTGGCTTAGCAAGATGAAGTCTGCTTTCATCCGCGAC
CAAGCACCCGATAGCGAAAAATGTTTGGTGTTCGGCGATCTGCTCAAGGGACCAGCGCGTAACTGGTACCGACAGCTAAGCAGGACTACACGGAGTGACT
GGAAGAGTTTATCTCAAACGTTCCAGACGCAATACTGTGGCAGGGG