Description :
From Genome Similarity Track
Location :
Scaffold_1376:9- 1217
Transcript NameFunction/comments
Physo_126684reverse transcriptase
Physo_126685hypothetical protein

Sequence
1208 bases(100 bases per row)
CACAAGGTGCATCTCCGAAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGTGAGATACCCGTGC
TCGGGTGTCTCGTCGGGAAGAACAGTGCCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACACCGTCGAACGTCAAGGAACTGCGGCA
GTTCCTTGGCTTGGCCACGTACTTGCGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTT
TGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGATTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTG
TGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCCCGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCC
AGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTG
GTCTATACGGACCACGCGTCGCTACGAACGGCTGTGAAGCCGCCGCACACCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCC
GGGTTGAGTACAAACCCGGAAGACTCAATATGGTGGCCGACGCGCTCTCGCATCGACCTGACTACGCCACGACTGATGCCGACGTCGATGCCATTGACGC
CATGCGATCGAGCACCCCAACGTCGTTACTGTTGGACGACGCGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCG
CCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTTGTGCTCGTGCACACCGTTACCGGGTGCACGGCGGGTTATTACTCTACAGTGCAGTCGACG
ACAACGCGGTCCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGA
GAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAG
CCTGCACC