Description :
From Genome Similarity Track
Location :
Scaffold_1405:9- 1107
Transcript NameFunction/comments
Phymu_g13230hypothetical protein

Sequence
1098 bases(100 bases per row)
GAAGTTTCGCTCGGCTTCAAAGACTGCGTCAGCAACTTGGTTTGAGTGGTACACGAAAACGCCTCGACTGTGGGAGGTCTGTGATGATCAACAGTACAAG
TCTCAGTAAAAGCAGATTGTGGCCTTTATGAAACTGTCCTCACGGGGTTCCCTTTGACCCCTCCGACGACCAGTATGCTGACCGCGCGATACAAGCAGGG
AATACAGCCCAAACGAACATGAACACTTTTCTTTATGCTCGCAGCATCAAGCTCAAACACGGGTCTGGTCTCCTGAAACAACTACGTGTATTCTTGCGCG
ATGGAACACTCAAAGACTTGTATCTGGATCCCGTGCTCGCCTAACTGTAGGCCAAATCAGAGATTCTGCCCCTGAAGAAACCAATGACATGTATTTAGTG
GCGTAGCAATCGTTAGCGCATTTCTGCGGGTAGCCATAATTGAtggcgttttcttcttctctattTAAAAACAAGAACTTGAAAATCACAAAAATAGTTG
TGAGAACCGTTACAAAGATTTTAAATTGTCTAAATGTAGAGGAAGTACAAGTCACTTACCCCTTCTCTTATTTGTAGTGTAAGCCAATATGTCTCTAAGT
AAAAAGGAGTTCGAAGAAGCATTAAGTGCATTTATACGTCAGTATTTCCCTCATGTCAGAATCtcaggagaagcagtacgCTTCCTGCGCGCCGAATACA
ACAGTGTTCCGCCCCTAGGTAACACGCCGATGGTCTTCTTGTTTTCCGCTTTAGGCCgcttgcttcaacttgaaccgcgtcgtcttgaaggGTCTCACGT
CCGTCTGTGGCGCGACGCACgtcatcaagacgacgctgcatTCGCACAGGCAACAGGTGAGCCCTTGGTAGGTGCACGTGACGCAGTCGGTGAAGCCTCA
ACGCCTGCCGCCGAAGCACAAGCCACCACCGAAGAGAAGCCGTTTGCCGCTGAAGCACCACCCGCTGCTGATGAGAGGCCGTCCACCGCCGAAGGGGCCT
ctgaagagaagctgcttgtcgcTGAATAAAAGTCACCCACCGCCGAGAATGCCGCCGAAGGGAAGCCgcttgacgctgaagcgaAGCCAATTACTGCA