Description :
From Genome Similarity Track
Location :
Scaffold_192:9- 1054
Transcript NameFunction/comments
Physo_144508OSJNBb0093G06.7

Sequence
1045 bases(100 bases per row)
CGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGTACGTCATCCACGTACACCAGTACAAGCACGCAGTGACCGTCCACCACCTTGATGTAGAGG
CACGGATCGAAGGCCGACACTTGGAAGCCGATGGAGCACACGAACTCGTCGAAGGTCTCGTTCCACACTCGCGAAGCTTGCTTGAGACCGTAGATGGCCT
TCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTTCCGGAACCACGCAGAAGACCACCTCCTTCATTATCCCGTACAGGAATGCTGTCAC
CACGTCGAGTTGGTCGAGGGGCCAGCCAAAATACTTAGCAATCGCGATCACCATGCGCAGCGTCACATACTTGACCACGGGCGAGAACGTCTCGGTGTAG
TCAATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGCACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGG
TATCGATGGCGCGTTGTCCGTTAGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCTTTGCGCCAGTGCAC
TTGATCAGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAACGTTGGCACTGGCACGCCAAAACACTGGAGGC
GTCGAGTCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTCGGGGTCGGCTCGGCGCGAGGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGC
CAGCTCGGTGGCGAACGGGGCGCGATCTTCTGGCAGTGTTGTCGTCGCCACTCGGTCGGTACTTGCGCTTCCCCGCCTGCTTGAAGCTCGTTTGGCGCGG
TCCATCGTTGTCGTCCAGGTCCAGCGCGTCCAAGTCCAGCACAGCATCATCGACGTCTTCATCCGAAGTATGCGTCGAAAGTCCAAAGGTCGACTCATCG
AAGTTGACATCGCGACTGATAACCACCTGCCCCGCCTCGATGTCA