Description :
From Genome Similarity Track
Location :
Scaffold_1382:9- 1048
Transcript NameFunction/comments
Phymu_g13197hypothetical protein

Sequence
1039 bases(100 bases per row)
AAGGCCACGAGaagcttcgccttcgaccGCTGTTGCTTGGGAGCATTTGCCATCCATCGCGGCTCCTGCGCGTACCACGCGAACCACGTTGTGCGCAGGT
ATGTTACTGATCCTCGgcgctgtttcttcttcgaagtactgACTCCTGTCGTGTCTTGGTCTTCACAGTTCCGCCTGTTTGTTGTCGTTATAGGATCGTT
GCTCTGCTTAGCCTCGAGCGCGTCCATCCGTGCATCCTGCCgcttgatgagctccatAAAGTGCTTAATGACAGCCGCTTGGTGATCGATGATCTTCTGT
TCGTGGGTTGGTGTTGTTGGCTTCTCGTTCGGGTTGGTGGAGTGTGTTTCGCTTCGTTTGATTGCTTGACAGGTAGCTGGATCGCGAGCAAGGTGCGACG
ACCATGCCAGTAGgtcagctgaagaacacTTGGCATGACTGACGGCGACCTCAACGCGCTTGACGACCTGACTGTCAGCCCTCAAGGCCTTGAGCATCGG
GAAGTAGCGTATCACACACGCGGTAAGTACATCGAGTACCTTCTTGTTAACGTTGTAGCTTTCTGTTTCCAGCATGtagcaggacgagaagagaACACGC
TGTACTCCCCAGATTGAGTCCAGAGTTTGCGCGTCGAAACTTGACAGGTCCTGCAGAGGTACTGCATCCCTCGGTTTGTATCCGCTAAGCACCTTCGCGA
TCTTGTGGTCTTCTTTActggtgttgaagatgtAGTTAAACCCTTTGTTTGTTGTGCTCATGTTCCAGGAGCCCCTGTCGAAGATCCAGCGTGCCGTCAT
CTCGTCGCAGCCATTCGCGTGCTGAGCTCCGCCGCGCCGGAACGAATGGGAAGTCAAGGCAACGTCtacaccagcagctcgagcaacGCGATCCAAGACG
CGGTTGACGTGCGCGTAGATCGTGGGTGCCGTGTCATTCCGTTTAGGTGCGGCAGGAGCGGGAAGGCCTGCAGGGACCGGAGGAGCgttcaagagctcca
gtagcgGAACGTCCGGCGACAGCGTGGCGGTTGTGGGGG