Description :
From Genome Similarity Track
Location :
Scaffold_881:9- 1028
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015270Protein of unknown function

Sequence
1019 bases(100 bases per row)
GGTATGTCTAGTGTGTAGGCACCATCATTGCATTTCACTACCTTGAACGGCCCAATGAATCTTGGTAGAAGTTTCGAGCTTCCCAAGTTGGACACTGCAT
GTTCAGGCAGATTAGCCGTGCTAAGTAATACAAGATCGTTGACCTTATATACTTGCTTGTTCTTCCTTCCACTCTTGTCTGCTTGTTCTTTTTGCAGATC
CTGAGCTTTTGCAATTGCGTCTCGAACAAACCTTACAATGGCTTGTCTTCTCACAATAAAGTCATCGACTTGCTGTGCCTCACGACTTGTCATGTCGTTT
AGAGGTTTCATCGAGTCGAAATTGGCTTTCAACTCGGCAACAGCATTCAGGTTCGACTGTGGCTCCTTAGCCATAGTCCCTCCCCCACTTAAGGTAGAGA
TTCCGCCTACTAGTGACGCTGGCACTCTCGGATGGAGTCCGTAGTTCACATAGAACGGAGTATGACCTGTCGAGACATGCGTAGAGTTGTTCAACGCAAA
CTCAGCGAGAGGGAGAAACTCACTCCACTCTCCGAAAGATGTTGCATAGCTGCGCAATACATCTTCCAGGACACGATTCACTCGCTCTGTTTGACCATCC
GTTTCCGGGTGTGCCGCTGTTGACATGGACAACTTGGTGTCCAGAAGTCTGAACAGTGCACGCCAAAACTTGGATGTGAAACGAGTGTCACGGTCAGACA
CGATCTCGACTGGTAGGCCATGTAGACGGAAAACAACGTCTACAAAGACCTTGGCCGTCATTTCGGCTGAGATCTTGTCCGAAACCGGTGCAAGATGGAC
CATCTTGCTGAATCGGTCCACAAACACAAGGATGCCATTGCGTCCGTGTTTGTCACGAGGAAGTCCGAATATGAAATCCATACTCACAGACTTCCAACTG
TCTGATGGGACAGCCAATGAACGAAGTGGGGCTTGCGTGGAGCCAGATGGCTTCACACGCTGGCAGATCTCGCAAGTTCTCACATACTTGCGAACCCACT
TGTACATGTGTGCCAGTAA