Description :
From Genome Similarity Track
Location :
Scaffold_246:8998- 10989
Transcript NameFunction/comments
Phyke_g8142hypothetical protein PHYSODRAFT_479167

Sequence
1991 bases(100 bases per row)
AACACGTACCGAAGACAACGATGAAACCAAGAGTGAAAACGACGGTCACGGGATCACATTGCGATTGCTGGATCTTGATGCGTTTGATAGTGAGTATTTT
TTAGACACGATACGAGCGGAGCGGCTATTCGGCCTCGCGGATCGTGACGACGTGAACCTACTTTCAACTCTTGGCGCGAGCTATTCCGAATccagcgatg
aggatgaagacgcgATGGGCGACATCGGTGAATCTAGTGATGAAGAGGTCCAAAACATTTATGACGACGAATGTGACGATGGTACAGGCGTCTACAACTT
TGGTATGATCGACGCTGAGGTACGCAAGATAGCTGCCTCTGGATGGACAACATAAGACGAAGAGCATTGTGGTAAGTCTGGAGAATACAGACTTAGAATT
ATTGCTAGTATCTTACTCTGTATCGTTCCTGATATGTAGGTGACTTGCAGTTAGACGCAGCAGATGATTTCTACGATGGAGCGTACGGTCCAACGCGCTC
TGTCATCGCCTACGCTGATTCATCGTTAGGTGTGCTCTTCTACTTCCTGCCTaaggaaatgtggacataGATTGCAGCCGAATCCAACACCTATCGAGAG
CAACTGATATCATTCATGGCCGTCTCCCGTCGAAACAAGCTGTTGACACGATAGGAAGACCCCGCGTCGGTGTACCCAGcctggaggagatcgaaTGCAA
TCTACGTAAGTTCAAGTCTATCAAGGAGTACAAAATGTTGCACACTATAGTGTTGCTATTTGCTCGAGTTGTGGCACCTATTCGTGACGGCCTTGCAGGA
CATTGGTGTCAGGGCGAGGACAGAGCTATCCCACGAGGTACTTTCCCCCGTTACATGAAACGCGAGTGGTTTGAAGCAATTATGAGGTTCCTACATTTCA
ACAACAATGAGAGCAGTTCTGCCGCTCTCGATAGGGCTTGGTCCCAAAGCTGTTATACGGAACGTCTCGAAGGTGTTGCGTGAATAGCCCCCAAAACGGT
TCGTCATGACGGACAGATTCTATTCCAGTATTGCTCTGAGTCTCAAGCTACTCAACATGAATTTGCATCATGGGAGCTGCACATGTTGACCAGTTGGGTT
GGTGCTCGGCGATCCAGTTCAAATAGACGCAGCGACCGAAAAGCATTGCGCGAGGGACCTACAGGATAGCGCAGGCAGTGCAGCATCCACAGCTAGTCGC
TCTGAGTTGGCTGGGTTCACAGCCGGTGAACATTTTTGCTACGGGGTGCATCACACACCCTGCCACCGTCAAACGACGAGAAAAGAATGGCTCGCGCAGT
ACAGTACCCTATCCTGAGCTGGTTGTGGATTATACGAAGGGTACGGGCGGGGTCGATGTGCACGACCAGCTCGGATTGCAGAGGTACAACATCCAGAAGT
GTGTGTCCTTCCGCAAGTATTACAAGCAGTTATGCCTGGGTATCCTTGAGATGGCAGTGGTGAACGGATATATAATCCACAGTATTGCTCAGAAGAGAAA
GGAAATGAAACCATCTACCCATTTACACCGCTCCATACAGAGCTCCTCGGACTGTGATCAATCAACTTCGAGACGCACCAACTGGCGGAGAATCTCGTCA
GTGTCCCTGTTCCGCACCAAGAGTACACGTTAGAGAACATGGAAGAGCGTTACCAGTCCTGAATTAACGACAAGCGCCGACAGCACCTGTGTAAAGTCTG
CTCGGCACACGCTCCCTCATAGATCAAGCCATTTGAGAGCAGCTACTTTGGGGCAACCGCGCTTTCAGAGATCAATCGCTACGAGCTTCGATAGCAATTT
CTATGGACAAATAAACATTTCTATGGACGACCAAGATCTCATTCTCACTTGATTTTACTAACAAGATAGTAAAATCAAGTCCGGCTGGAGCTTCATGATC
TCGCAATATGGAGGATCCAGTCTGATAATGGAATCAAGTGAAAAATGATTAGGTAGACTACCTCTGTCCCAATTTACTCGCGAATCAAGGT