Description :
From Genome Similarity Track
Location :
Scaffold_239:8997- 10962
Sequence
1965 bases(100 bases per row)
TTGCGTCTCCAGAGGCAATTTCGCCAAATAGCTCTGCATGATGTCCGGCCCAACTTCAGCGTACATAACCAGAGTCAATTGCTTTGCAGCCTCTCGAATG
TGTGGGTTCGAATGAAATTCAGCGTCGCTCCGCAGCAAGAAGCGGAACAGCCGTCGTGGTGCGATGTCAATGCTTGCACAGCAATGAAACGACTGCAATA
GTGCCGAGATGAGCTTGAGAACTGCGTGGAGAACCTGGTCTGTGGGCCGAAGCTGCTGCTTTTCGAACTTCTTGAGGACAAAATGCAGCACAAAAGTACC
TTTCGCCCGAGTCGAGTCAGCGACCTTTAATAATGGCGTAAGTTCATATCATCGTGGTTAGACGATAGGTGAAGTGATCGACCTTGGGATGAAGGAACGC
CAAAGTGGCTACTCACTTTCAAGATCGAGAATGCCGCGTTATTTCGGATCTCTGGCTGATGCTCGTCCAGCCTTTGCAGCAGTATCTCCAGTATCTCGGC
AAGCTATACATTCATGACGGACTGACATCAGCATAGTTGATCAACAGTTTCAAAGATGAAGCGCGTACTCACATCGTTTTTGCGCGACACAGGCTCTTGG
AGCTTGTCGAGGCCAGTCAACACAATATGAAACAACGAGCATGCAGCAACAAAAACTTGGCCGTTGGCATCCTGTAAGACCGATTTTACAAGATGAAGTA
CTTCCTTCATCAAAGCAGTTTGGTTCTCCATGTCTGCGTTTTCCTTGGCGAACGCGACAAGTTTCCATACCATGTCTTCTCTGACTTGCCAGATCTCGCT
TTGTATGCTTTTCTCCAAGTCAGGGAAAGTCTGGACGATTGAAGTGCGCAGAAACTGATGGCGTTCAAGCAACTGATCGGGGCTCCTAAGGTATTGTTTC
AGAACTACCTCGCGTTCAGCCACTTTGGATCCAAGCGCGCCAAACTCCTGCAACATGGAGTCGATATCGTCCTGTAGTGCAGCTCGTTCGTGTTCAACGA
TCAAGTGACTCGTGTCGTTGTACGTTCGCTGCAAAATCTCCAGTTTATTGACCAAATGGCGGTATTCCAGCTCCATCGCCCTCCATGCTTGCGCCACGAT
TGCACCCTTGTTTCCTGCACTACGTGCACGTTCAAGGCACAGCGTGATATGCGTGGAGATCTGGAGAGGAGTTCTGTACTCTTGGAGTTCTGGGATCCAG
ATTTCGTAGTTGCTCAGGCTATTTTTTTCCGCGAGATGAGTAAGAATTGACGAAGTAGACGCGTCGAAGGATCTTACTCCGTGGACCTTGCGCAACGGAG
AAAGCGCGTTCGCGTATTTCGATCGTATTGGCGACAGAGAAGACGAAAACATGTGCTCGAGCTGCTTGTCGGGGTTGCTTTTGTTGTCATGCTCTTCAAA
CGATCGAGTGTGCCGCAGCGGAGGCAAGCCATAGCTGGGCTCGCTCAGACTGGAGATCCCTTTCGCTCCATCCCACGACAAACTACTGTGCAGCAAAGTA
GTACTTGCCTGAGCGGCCACTACGGAGAGCAGACCGACTTGCTCAAACATGTTCTGCTGATTCGCATGGCACGAGTGCAGCACGAGCCTTATCATCGTGA
CCTTCTCATGCGTGGGGAATGCAATGATCTTGAGCTCTCGGGCCGTGAAATTGGACTGTTCATTGCTTTGAAATGAGACGAACCCAAGGCGCTGGAAGCG
GGCATGCGTTTCCCACTCGAGTCTCCTGTACGCGTAGCTGGACGTGAAGATTTCGATTCGCGACGCGATCTTTGCGTGGTGCGACAGCAGATACAGCTAC
ACAACAGAGCAGCGCAACGACGCACACGCATGGTTAATACAGCCCAAGCTTCCGAACAAGCGCAGAATGCCGAGCAGCTCGTACTTTCTCAATCCGCGTC
GGAATCCCGCGATTGACGCGAAACACGAGCTCTTGCGGGTATTCACAAAACTTCTCCGACGCCCA