Description :
From Genome Similarity Track
Location :
scaffold_1:899672- 904142
Sequence
4470 bases(100 bases per row)
TTCCTTCTGTCGAACGTGGCATTTCGACAACGGTCGATTTTATCTTCGTGCCGTCAAGACAGCAGCACACTGCACGACTATGTACAGAAGCTCCGTGTGC
TTCGTGCCAGCATGGCAAGCGAACCAATACTAGCGGCAGTGATGGCCACTGTTTTTATGGAGAAAATTGCTTATAGTCCTCCTAAGACTGAAAGCTTCGG
CCAGGATCGACGACTCTAAAAGATGCAATAATGACTGCATTGCGAGGGGACTACTGTCATCGTCAAGCATTTGGTCAACCGGTAAACACCTTGGAAGCAG
TGACTACTGTACCGGAATTCCGGAAATTCATGGATCTTAGCACGGTGACTTTCCATGGTCAGCAAAATCGCTATTACGAATTTTCACGATTCGGTCATAT
CCGCCGTGATTGTTCACGTTCTCATCGTAATGGTCCCGAGTCGCGTGGTACCAATACAACGAGGCGTTTGGGAAACGCCTGAATCCAGTAGACGCAGGAA
GGTCTTCCGGGCCATTATAAACTCTTGTGGGTTTCGTGGTAGAATCACACACGAGAGTTTAGACCTTGAAGAATCGCCGTCCGTCGTTAACATCACATGT
CGGAGAGGTCTCCTCGTGGTCACAGCGAGTGTAAGAGCTATGGTCGTCCATTTAGAGTTTGATTGACTCTGGTGCGTCGCGTAACAACGTGcggaagcaa
agtgttgctgtAAATGGCACAGTGCTTTTAGATGCACTAGATAAAAGCAACGACTCTATTTGAGTGAAGTTGGCCACTGGCGCGGTGGTCAACGCAAATA
AAATTATAGTTAATCTTCAACTGAAGCTCGAAGACTTCAACTCGAAGAATGTATTCATATCCTCGAGATGGACAAAAAGTATGATCTGATTTTAGGTATA
CCGTGGCTTGAGAAGCAAGTGCCATGGTTTAATTGCGATCAAAAACGATTGAGAGTAGCCCTCCTAGCGTAGGTAAAACCCCTGGGCGTAATGAGCCCAC
ATTCCCCAGATACTGGAAGAATCGTTCAAGCGCTTGACAGTCGTATGTTGCGTATGGAGTAACTACTATTATCACTCATGGAGTGTGTCAACTGCTCGGA
ACTGACCACTTAAAACGAATGACCGTCGGTGGTATGACGATTTGCCTAACGGAAAGAAATTATGAGGGAAAGATTGCGGTTGTTGCCCCCCCTCTCAAGA
CAGAGGGATGTTTTCAACATGTCTGTACTGGAAAGTCGAAGGGGTCGACTGCGGCTGTATATGCCACTCTTTCCACTAACACAGTGGCCAGGCCGGATTG
CGGATCAATGGGTATGATTGACAACACACAAAGGTGCAGTTCCCATCGGTTGTGTGGTTGAGCACACATATGTGAAGGAATCACCGGATTTGTTGATAGC
GGTACTGATACTCCCGCTCTGGATGCGGTTGAGTCCGCCTATGAGTTAGTCCAGCATACTATTCCCACGATGGAACTGTAGCATGAGAAGATGCTGGTCC
AGGTATTGTGGATGAAACGGATTGTAAAGTTACCAGATCAGATATTCTTTTAGAAATATTTCTGACGACGAAAGAGGTGGTGCAGCTTTAGGAAGTCACT
AATGATAGCTTCCTAAACGGCCTCAAGTGTGATGGTATTTCGGAGGTCGTGTTGCTACTGTCGAAGGTCGATTCAGCGGAACTCCCCCTTATTATCAGTT
ATGGATGATTCGGATCTTGAagaattttgacagcgtTTGGAAATACGCTGAGGATCTGCTACTCTGAGGGATCCAGGTGATCCATAATTTACACTTGTCA
TGGAATACAAAGATGACGTCCTTAAAGCGGAGCCACCCTTTTGTTTCCCACCCGAACGTGAAGTTCGACATGAAATCGATCGTGAACCTGGTTCAAAGCA
TACAGTGCTTCtacagtggccactgtcgcgTGAAGTTCGTTAGTATATTGATGGGTTCTTTGCTCAACAGCCATCTGCTGGTTTGGTGAGGAAAGCCAGT
CCCCTCACAACGCGCCGACTTTTAGTGTGCGCAAACCAAATGGGAGAAGCTGCATTGATCACGCCTACAACAAGTTAAATGCGCGACAATTTCCGCTCAA
ACGCCGGTTTCACTAAAGAATGTGATCAACCACCGTATGTCCGGCTGTACACAAAAATTGGATTTGGTTCACTAATGAGGATGATGTCTCGTTGACTGCT
GTTAATACACCATCCAATATGTTATGAGAGTGGCTTGTGATACCACAAGGACTATTCAATGTCCTAGCAACGTTCGATCGATTGGTTTCCCATCTGTTTC
GGTTACTGCGACGCTTTGCACAAACTTATTTTACCCacatttttgctttttcgAAAAACGAAGATGGTCGATCTGCCATAAAGTGCACTTGGAGCACCTC
CGTATGGAGTTGAAATGTATGTGTGAAAATTCATAGCCAGCGAATCTTGCTTTTGGTGAATGAAGTACCGGAACTTGGTTGTTTTGTCGGTGAACGCAGC
GATCGTGCAGACCCAGAGAAGGTCAAAGCAACTGTGCAGTAGCCGACGCCTCGGAATCAAAAAGAATTGATGAAGTTGAAGCGTTTTTTTCAGCTACCTG
CATCGTTTCTCGCGTAACTACGCGGACATGGTTCACCCGCTATCAAACTTGGTGAGGAAGGACGTACCATTCGAGTGGTCATCCACTGCGAAGAAGTATT
CACTCAGATCACGGACAGCTTACTTGCTATACCAGATGAAACGATGTCGTATAGCGTGGTGTGTGATGcttctgagtttgcaatcggtTGTGCACTCTTG
CAAAAGAACTAAGATATACACGATCATGTCGTGTCATTAcaatcgcgacagctgaagcAAGCAGAAAACAACTACCTTGTCCGTGGCTGGAAGctttttg
caataaattaTACTGTGGTGAAGACCCACGTCCACCTCATGGGTTTAAGTCTGCTTGCCGTCTCCCTGGATCACACAAACTTACGTTATGCAGTTCATCC
CCCTCACTTATCACAGCGGGTTGCTCGCTAgttgtcattctttgcagactaCAACTTCACGGTTGTGTATAAACCGGGAAATTTGAACGTGCCGGCTGAC
GCGTCGAAAAGTCAACCAAATTATAAGCTAGCGGATATTAGCTATATTGAAAACGATGTATTCGATATGATACTACGAGCGTCTGTTAGATAGACAGTGC
GAACCGAACATCGAGGCACTCTCACTAAGTGACATGGAGCTCCATGACAAGCTTCCTGATCGCTTGAAATCAAGGATACATTGTTATGCATGAAAGGAAG
GTCTATTTCACTATGAAGTTGCACAAATGGTATCAAGCCAGACTAAAGGGATGTGGTCTTAAAGAAGCTGGTGTCGTACGGATTGTGGCTCCACGGAACG
ATGCGTTGAAGCACAAGGTTTGTACGAGGCGCATGATACGACGATTACCGGTCACTTTGGCCGTGATAAGACCTACCAATCCCCCCCAATGTGTGACGCT
GCATGTTCAAGTGGGTTGCACGATTGCGATGTCTGTCAGCAAGAGAAAGGCACACGGCACACGCAAGTGCCAATGCAGAGTCTCCCAGTTCCTACTGATT
GTTGGAAGTCAGGCGGTCTCGACTGTATCGTTGGCTTTCCCGAAAATGATGAGGGTCACAACGAAGTGCTCGTCTTCGTTGATAGTCTCAGTAAGATGGT
TCGCATGGCTTCGTGTAACTATTCCGTTGCTTCGGCTAAATTATTCTTTGTTGCCATACGCCATCGCATCTGTTTGTGTACACTATTCACGAGTTGCCTT
GGACAGAATTGTCTCGAACGCTTGGCATACGCTAGGATATGTCACAGCGGTACACCCGGAGACCGATTGGTAAACAGAACGTGCCAACCGAGTGGTCGGT
GATGTGTTGCGAAGCTTCTACGCGGATAATCCTGCAGAACGGAATTCGTTGCTACCACTGATAGAGCTTGCTATAAATCATCCGCTGGAAATAAGCCATT
TTTATAAATGACTTGCGACACCCGCAAGTACCACTATGTGCGATGTGTGGTGTCTCTGGCGTTAGTGGGAAGGAGCTCGGCAAATCATTACCTCTCAAAT
TACTACAATCAATGATGCGGAATGTGAAGCGCAAGTACAAGAATGCCGTAGACTAATTCATCATGGGTCGTGCGAGTGTGATGTCACGAGTGTGAGATGC
AATGGCGAATGTGCAAGATCTAAAAAGGAATACGCAGATAGACAAATCTGTCGAggcaaaatatattttattgTTGGGAATATGTACTACTTAGTACCTA
AAACCTATCAGACGATGCTCTTTCAAACTTGACAAGCTCAGTGCTATTACCTCGCTTCATCAGTCCATTCCGTGTAGTGTCATGCCATGGAAATGCTTAC
ATCATCGAATTGCCAACTGGCTCAGGACACATCCAACGTTCTACGTAGGCAGCTCAATCCCTGTCATTAC