Description :
From Genome Similarity Track
Location :
contig_235:8994- 14055
Transcript NameFunction/comments
g12225.t1hypothetical protein PHYSODRAFT_551054

Sequence
5061 bases(100 bases per row)
CGACGGCCTTACCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCA
GCCTCGAGAGTTTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGG
GTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTGCAGATCGAGGAACTCCGCCCTCGATCGGA
ACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGTCTGTGAGTCGGCGTCCGTACGCCCAA
CTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCC
AACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGCTCGAGC
GGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCA
ATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCA
CGGACATGTTATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTGTAATGGGATCTGCTTAGACTCACTACTTAAGCTTACACGTGTGCGC
ACGTGTATGAGGAAGCGTAGGTGTATTTAACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGTTAACGGAACCGAACGATAGCTTTGG
TGCCAAATGAGAACCGTATTGATTGTAAATGGGGTTTCCTCCTATAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATC
TATTGAATGACTCTCAATGGTAGAAAGATGTTACTTTCTACCAGCCGTATGCTTTTGGCTATGAATGTGGACCACCCTGTAGAGTGGTCAACCTGAATGT
ATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGTCCCGCTACACTTTCTACGACGAATATTTTGTACGGAGCCGACGTCATCAT
CATTTTCACTATCATCATCGAAGAGCCTCGAGGTTGATTCACTTATAATCACCGGATGCAGCGAACGTGAAAGGACCGAATCAGATTCAGACTCAGATTT
GACCGACTCCGAGGGCATGTCGGATGGCCACCGGATCCTCACAACCCATCGCATCACCCTTCCCTGCACCATTGCTAGTCGTGTCGCCTTCTCCTGCACC
GTCATTCCGTCACGTGTGCCACCAACGTCCGATGCAGACGATTCCGACGAGATGAATAGTCAACAAACGTTGCCCGCGACGCCACAGCAGCTGTAGCAGC
AGCAAAATCTGTCGTGGAAGCCATGGTGGCAGCTCCTAGTTGGAACCTACTCGAACCTAATGCAGCCAGGCCCGAAGGCTAAGATAGCCTTGGTTTAAGC
GAATCCCAGTCAGGAGCGAGCGGATTTCATGCAGGGTTTGCTGATCAAGGAATGAACTGAGGGGGAAGAAGGGTGAGTGTTACGGAAATAGCAGTGAAGG
AAAACTCTTGGTAATTTACAGGTATTTTACAAGTATAGTGAAACTCACAATAAAGAGTGGTATGTGAAGCTTTAAGAAGCTTCCAATTGGTTGAGGGTGG
GACACAGGCATATATCACTTTAGGTAGGATATTATATTCAGCAAATAATACTGTCTATATTGTGTATCTTTCCTTTCTAAACTGATCATGTAATTTGCAG
GGTATATGTGATTTCGCAAAATCGCACTGATCGCATCCCAAATCTTGTTCTGCAAAGTGATCAACGTGACCATGGTGCTGGCAATTGGTATGTGTGGCGC
TGTACAGGTTCTTAACGAGCAGCGAAGGTGGGGATGGCGTCTCCGGTATCACACGCACGCGCCAGCTGCGTCATGGGCTCCGCGCTCTGAAACAAGACCG
CGCAGCCACCGCCCATCGCGTGTACGACCCCGTGTCTCGTTTGGCCTATTCGCTTGTGTGTGTGTGTGTGTGTGTGGGGGGGGGGGGGCAGTCTGAGAGC
GACGAGAGCTTCTGCCGCGAGACAGGCTTCCACCAGGAGCTGGACTGCCCTCGAGGAGAAGACCCCACGGCAAAGAACCTGCTGACCGAGCCCGAGGATG
AGCGCGGGATGTGATTCAAAGTGAGTTCACCTGCAGACGCAGCCAGTTGTAGCGGTGGTTAAATTCGAGGTATGGGGCTGCAACGATAGCAAGGATGCTG
TGCTTGAATAGTGCTGACTGTTGATGCTTGTTCGTTGCAGGCGGTTGTGGCAATGTTACTGGCAGTATTGATGCTGTTTGTACTACGGCATCAGCGTGGC
AGCTCTTTCGACATGTAGAAAGGCCCGCGATAATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATT
CAGGTTGACCACTCCACAGGGTGGTCCACATTCATAGCCAAAAGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAG
GGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAA
GCTATCGTTCGGTTCCGTTATCTAGGTTTAAATATACTTGCGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCA
CACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACAAATGGGGTGGATTGTTGGACGGCGCTGCGTCCATCAGTAGGCATGATGTCAACATCTT
GCATTGGTTACAATAAGAGTTCGTTTGCACGTTCAGCTATGTGCTTCATGTTGAGATCAAAAGCGACGTCTACTCTAACTGAGTCTGTCTATTGAAGCAT
TGGCGTGCGTGATTTACTACATTTGAGCGCGTGATCCCATTCAGTAGCGTTCTTTTGATGAAAACGTCTGGGCACGCTTCCTGAAGATGTCAGCGCACCT
ACATGCTCGCTAAAGCGCAAGGAGACTGTGTCTTCGAAGAAGTCCTTCTTAGTGTTGCCTGTGCTCTGGTAGTCGCGCGCCTTCTTCTTCTTCTTGCCAA
GGAAAATATTGTGCTTCTCCCTGTTGCGTCGGCCCTGCTTGACGGTGTCGTAGATGACGCGCTTGCCCTCCGTACCGGTGCACTAGTTGAATTCATGCAT
GCTCGCGCCCTCCGATGTGAAACCAACCATAGGCTTCTGCTGCTTCTTAGAGCCATCACCATCCAACGGGAACGTGCGCGTGACTAACCGCTCCATGGCG
TTTTTCGCTCATGTACTTGCGGTAGCGCTATTTGGATCGCTAAGACTTGGTGGACGGTAGGTCGAAGGCGTTCTGCTTCTTGTCATTGTCGCGCTCTCCA
TTGACGAACGGATCACACTGCTCGAGCTTCCTCACGACGGCGGAGTTGACACACTGAACTAACAAGAGGTCGTTTTCGATTAGCCTTCCTTCGCGGAATG
TCAGCCTCGTATGTGACGCGGATGCGTGCTCGGAAAGATATGGCGAAGATACGCCGGGGTCCCACATCTGTCATTGTTGCCAATATTGCTGATTCTGTCC
TGGCTCTGACGCTTGCAACTGCTGCTTGGTGAGAGCGATGCCCTTTCGGAATGACACCCAGCGGCCAGAAATCCGAATTAAATCATTTTGACCTATCACG
ATGCGTTATTAGACCCCCTCTATGGAGACATTTTGCCTCCTTCTGTTTGCTAACTTCTTGGATTTGTATAGTATACAAACTCACTGTGTTCGAGAAAGGA
TTTATAGGAAGCAGATATCCTTGAGAATCACTTGTATGAATATCAACAAGTACCACCGAGACATCGTAATCGGGTCTGGGTAAATGGGAGGGGTGATTTT
AAATCCGCCAAATCCAGTCAAACGATCGTTGTACTGGTAGCCTAGAGCTTTCTAACGAGCCCACACATGCCTCATTTTGGTTTAACTAGAGCTGTTGACT
TTCATGATTTGAGTGTCATGACACCCGTCGTCAGAAATACGCCTCCATTTGGTGGTAGCAACATCGTTCAATAAGGTGATCCATGAGAACACCATTGACG
CTGATAATATCCTTGGTGAAGGCAGCAGAAGCAGCACTACTATTAATTAATTGTAGAAAATGGATTGCTGTCAATCCTGTTAGCCAAAGAAACTCGAACC
TAGAACACTGCACCAGCGGCTAGTCGATTATAATCACCTCCGTTTCATCTAGTGTTCTTTTCTTTTCAGTCGTGTTTCCTTGATTGCGTGCATTTGATTG
CTCATGTTTCACCTACTTGAAGCAAGAACAGAGGCCCTAGGCGCAAGATTTCAGCCATATAATCAGGCACTTTCCTTCTCCACGGGTCAAACTCGCCCCC
AGTTTTCTGAACTTGCACAAACACTTCACGATCGTGTCCAACCCTCGATGTGACTTCGAGTGGGCCTTTGGTGCTCTGTTGTAAAATGCCGACGAAGAAG
CGCGCATTCGACATGCTCGAAAAAATCCTTGCTCACTAAAGAAGGTCGTGGGCTTTGCAGTTACTCCATTATTTCAGTTCCATGAGCAAGGTTGGCGCTC
ACAACTTACCAAGGGAACGGCTTTTAGCAGTCCATTGTCTCGTTGATAAGCTATTGACGACGCGTCCACGCAAGAGAGGCCAGCGCTGTTTTGTGGAGAG
TGGTGAGCTCATTGCATCAACGTGCTGCGATAGTTCGTCCACAACTGGGTCTAACAGTCCC