Description :
From Genome Similarity Track
Location :
Scaffold_76:89908- 91356
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11000Hypothetical protein

Sequence
1448 bases(100 bases per row)
GATGCCAGAGTTGATACTATTTCAACGTCGCCGCCGACGGTGACGGTGCACCCGGTCGCGCACCCAACTCAACACTCCGATTCTGTTCATCATCTGCAGC
AGACAAGCCTATCTCTCTCGCCCGCGCGCATCAAAGCCTTTGAGGTACCGAGATGACTGGATAACCGAGCTTTATCCAGTCACCCCGTCGACACTCGCGA
GACGAGGCTAAAGCAAAATGCCAGCAGTGCGCAGTGGTTTCCCGACAACGTTGTCAGCGTATCGAGGTAGTAGCGCGCGTCGGCAACCTCCTTTTGAGGT
TGCATGGAGCAGAGTCTTGGCGGTAAGCGACTCGGGTGTCGATGGACGCATCGTGCTCGTTAAGAGTCTTGGAAAGCAAAGATCGCAATCGCCAGTTAAA
ACGACGTATTGATGTCAGTCGACATTTTCGGAGGGGTCGCTTGCCGCCGCGGTCGAAGGCGAACACACTTCATGCTGCTGCTGCTTCAAGAGGTTGAACG
CGTCGCGCAGCTTGGCGGTTCGAAGCGCTTGGTACCGGTGCAGCACCGAGAGCATTTGAAGTCCGACGTCGTAAGGGTTGATGTACGCTTGGGTCGGCCG
CGCATGCACGAGCGCCTCCATTTCGCCCAAGCTGTGCGCTTGAAAGACGGCGCGCGAGAGCTCCATCGACTGCTGCCGCCGCAGCTGCGTGGTCGGCGCC
TCGACCTCCACCGGCGTCGGACTTGTCTCTGTCTCAAGGGCGCGGTACACCACGACGCGCCTAGTGTGCATCGTATATGGACAAGATTGGTCCAGTGTAG
GAACGCACCAGTAGACAAAGACACCGAGTGTGGCACATGTCAAAAGTACGAGCGCGAGCCATTGGTTGGCGTTGCCGAGTTGAGATAAAATGCTCGTCAT
CGCCAACTATCCAAGACCATGAACATGCGGCGATTTGAACCTATGTCGTACTTCAAACAGGAGGAGGCAAACGAGTGCGAGCGAGTATGCGGCGCGAGCC
ACGTTGCCGCGGCCCGGGGTCTTGGGGTGGACGTACACAAAGTTGTACTTGGAGACATAATACTTGGCGAAGAAGAAGACGGCAGCGCACGGTACGAGGT
ACGGCGACAGCACCGAGCCCAGGAGGCCGATCGTAAAGACGCTAGGCACACGTCATTACGTACTCTTGGTACTCACGGGATACCTCAGGAGAACGGCATA
GTCATAGCCAAAGTAAAAAGGCCATGGCTCGCGCGCGGCTTGGACTTCGTCCGTGGTCACAGCGCGGGAAATGACCCTCCAGGCATTATTGTCGATTTTT
CGTTGCGTAAAATTGCCAACCATGGCTGGTAAAACAGCTTTTCACCGATACGAAGCAGCTGCGTGAGCGACCCAAGGCAGGTCCTAACAATATATCGCAC
CATGGTCTCCAAAGTAGGGGTAGGGTCTGCACGTACAATTGCAAAATG