Description :
From Genome Similarity Track
Location :
scaffold_9:89856- 91407
Transcript NameFunction/comments
g4497.t1hypothetical protein

Sequence
1551 bases(100 bases per row)
AAGGTGGAGCGCTTCGGCATGGCGGTGAGGTGAACATTTGGAGTCGCGAATACATCGGCATTGTCGCACAATATGCCGCTGTGGGTATGATCTTTGGTAC
GCTGCCCGGCACAGTCTATCCATTCTTCTTCAACTACCTCAACATGGAAGGCACACAGTCGTGTCGGCTGTGGTTCTGCTCAACATGCCGTGGTCGTTCA
AGATTTTTTACGGCATGATCACCGACTGTGTTCCTATCTGGGGCTACAGACGTCGTCCGTTCATGGTCATGGGGTGGACGTTGTGTTTTACGATGCTAGT
CGTTATGGCTTGCATGGATGCCGGCGACCCTTATTACCCAGACAACAAGTACGCGACGATGGATGCCGAGGAGCTGACCCCTGAACTCGTTGCGACTTTC
AACGAGTCGGCACACCACGCGGGTGGTAAATTCGTAGTACTCATGATGATTGCAGCGGTGGGGTACGTCGGAGCTGATGTTGCTGCTGATGCTATGATGG
TGGAAGTAGCTCAACGTGAGCCAGAGGTTACACGGGGATACACACAGACCACGATCTACATGGTTCGAACTGCGTTTGTGATGGTCTCCAGTATCCTCAC
AGGTTTGGCTTTCAATGGCAAGGACTATGGTGGAGACTTTGATTTCTCGTTAACTTTTCCGCAGCTCATGGTGGTTCTCAGTTTATACTGTTTCCCCGTG
ATCCCCATTTCGTGGTACTGCATCAAGGAAGACCCTCACCCGGGCGTGATTTTCCGCGACTACTTGGCTGAGCTTTGGCATCTCATCCAAATGCGCCCGA
TGTATCAAGTGATTGCGTACAAGTTTCTTGCTGGCATTTTCGAGAACTTCACCATAACGTGTGCAGACCCGATGCAGTCGTACTGGGCAGAAGTCACGCC
ACTGAACCAAAAAGTAATGGCGATCCTGGGCAATGGTGTATTCGCTATCACGCTCTATTTGACTGGCAAGTACGGTCTCCAATGGAACTGGCGAAAGATG
CATGCTATCACCATTGTCTCGGTGACAATCATGGACTTCATTGTAACGATGCTCACGACGTGGAATGTCATACGCAACCAATGGTTCTGGTTGGGAGTGC
CCGTAGCTGAGGCTCTCCCGAATGGTATTGCTTTCGTGATCGCGACATTTGTGATGGTGGAACTCGCGGGCGAGGGCAACGAAGGTGCCGTGTATGGCCT
CGTGGGATCGATCTCCAACATTGCCATTCCTCTGGCCAGCACATTTTCGAAAAACGTGGGCAGCCATTTCGACGTGACCAACGCCGATATCGTCGAAGAC
TCGACCCACGTGCGCTGGGAGGTGACGTACGTTCTCATCATCCGTTACTCCATGAACTTGGCCGGACTTCTTTTTCTCCCGCTACTGCCTCGCCAGAAAG
CGGAGACGCAGCAGCTCAAGCTCAACGGCGGCTCTAGCCGTATTCTGGGGATCGTGACATTATTGTACTTCATCATCTCGTTGGGCTGGACCGTCATGGT
AAATATCATGAGCATTTACCCGTCCACATCGTGCCTACCGATCGCTGGTGG