Description :
From Genome Similarity Track
Location :
scaffold_468:8985- 10557
Transcript NameFunction/comments
Pl_104609hypothetical protein PHYSODRAFT_473010

Sequence
1572 bases(100 bases per row)
GGCAGACGGTTCGCTAACACATCCATCGCAGCTTCGTCAGCAGCTTCTTGGAGGTCTTTTTCGCCAGCGTGCGTAGCAAGTTTGGCCACGAGCATTTGGC
AAGTGGTCGCAAACTCCTTTGCCTTTGCAGAGTCCACTGGAAACTGGGTACCCATAAAGTTTAAATAGCCAACAGGAAGTCCCTTACGAAATGCAACGTC
AGAGTCGAAAGCTTTACGGATGACACGAGGCAGCGCCACCTCCAGGAAGTTAGCCCATGTGTTGTGCTGGTACACAGAGATGGTCACATGTGTCGAGAAT
TCCTCCTTGTCTGTGCATGCCTGATGCACAACGCCGCGCGGGAAGTACAGCAGGTCACCTTCCTCCACAGTCAGCTCCATCCATGGCTCTCCAATCTGGT
CCTCAGCTAGATCCGAGCTGTGTTCACCTGCCAGCTCCACCAGAGGGTGGTAAAGCTTCCACTTCTTGCGTCCTTGCGTCTGCAACACAAACACTTCCAC
ATCATCGTGATGCGGTGCCAAAGCCTGCGAGTTGGCAGGCGTCAAATACGCACTGGCACCTGCTAAACCGCCGAAAACCTCTTCAAAAGCTGCGTTGAGT
TCGTACAGTCCGTCCACATAGCGCTGTGGTTGGTAGAATTGGCAGCTATAGCCTCTGTCCAGCAAGCTGGCCACCTGTCGGCTAGTGGCATGGCCATTGG
AGTCCTCACCCTCAAAATTCTCACGCTCTGAGTTGACGTATCTGCAGACTGTGAGGTCCTTCCCGAATCCCATGTGCAGCTGTTTCTCCATGACCTTGAG
AATCTTCTTGCGCGAGAACAGGCCATTGCCGAATAGTGCACCCTTGTCCGCCTTGCGCACATGCAGTGGCTTCTTCTCAAAGTACTCTGACAGAAACGTG
TCGAGCGACATTCCACCCAGCAGCTTGGTCAGTGTGCTCTCAGCCCATTGGTGACTGCCTTTATCAACATTGACGGTTGCAGCTGCAGCCTTTGTTGTCG
CAGCCTTTGCAGCCTCTTTCTTCTGCTTCTTGTTGGGTCCGGGTGTAGTTCCATCGGCATTGCGCTTGCCGCGACGCGCTGCCTTCTTGGTTCGACTCAT
GGCTTCCACTCGATTTGATGGCAAGTTGAAACGGTAGCTCGATTTGGTGTACAGATATTGGTGAACATAGCTACAATGTCGATAATATGTGTGCCACATT
AAGTTGGTGTACATCCGGTGTGACAGTTTTTCGCACAGATCATGTCGGTTAGTGCCGCGTCGGGGGAAGTCCACGCGTCAGCGCTCGCAATGCTGGCTGA
AAGCAGCGCCGCTAGGTCCGTGTGTACCAAATCTAAGGGTTTATATGAAGTGTGTAATGATAATAAATCGGTTATTGCGTGGTATTCGGTCCAGGACGAA
GAAGAGCGAAGTCACGATGCCTCAGACGGAGGAAGAGCACGGTGAAGCAGAGATGGAGCGTGTGCGTGTGAAGCTGGAGAAGGCTCGGATCCGGATGGGC
ACGTCGTTAGCAGATATTCCAACTGGTCGCGAGTACGACACACCGCCGGACGTGTCAGATGAACCTGTGTAC