Description :
From Genome Similarity Track
Location :
Scaffold_480:89849- 90948
Transcript NameFunction/comments
Aphin_H310_14528aminotransferase putative
Aphin_H310_14529Hypothetical protein

Sequence
1099 bases(100 bases per row)
AGCTTGCGTTTGGGCGACGAAATCGGCACGCACACTGTTTACTTTGCCGGTCCTGGCGAACGCATTGAGATCAAGCACGTAGCTACCCGTCGCGAAGTAT
TTGCCCTTGGTGCGTTGCGCACGGCTGCGTGGGCCGTGAAGCAGCCCAAGGGATTGTACTTCTAAACATCGAGGGAACTTTAACAATAAGACATATACCA
CCGTGACCCAGCTCTTTGTTGTGCTCGAAGAAGTGGTGTTGTGCTCGAATGCACACCACCACTACTCACAACAAGGCATCCGACTTGCTGTCCTTCGTTG
CAGCAGTGAGATATGTACGATTGCATAGGATTTCTCCTCGAAAACATTGTTTGAACAATATCAATAGTTGTGTTATTGCGATCAGGTTGGCACCGCGACG
ACTTCGGGACACACCGGCACAATGGATTCCGGGGCGGAGGGCGCATCTATGGGTACATCAAAGTCCGCGATCGCTCGGCCGGGGTGGTTGCCGCCGAGGA
GTTTTGGAATGGCGTCAAGGGAAAGTCCTTGTTTTTGCGCTTCAGCGACAAACGCGGCGGATGACTTGTAAATTTGAATCTTCTGGCGGGTTTCAGGGTC
GATGAACGACGACACGACCTTCCACGTGCCCCAAAACACAAATGGCGCGTTGACCAGGTACATGCGGAAGAGGCTCTCCGGGTAGTACACTTGCCCGAGG
TCAAAGATTGGCTTCAAGTATGACATGACGCTTGGCGCAACGTGCTTCCATGCCATCCCAGCCAAGTCGAAGATGTAAATGTGCTTGTACACGAGCTTTC
CCTTCCTCTTCGACGACGCGCCGAGCCTAGTGCCCAACGTCATGGCGGTGGTTTGTTGACTGTACGTACTCTGCTTGAATACGTTCCAAGTGTTTCATAC
GGTGGCGCAGTATTTCATCCACAGTGAAGTTAGCGTGAAAGCTGTCGACGTTGATCTCAACCAACCGTTCCATGTTGATGACATGGCCCGCCGTGTCTTC
GCCGTATACGGCCGACGGCCAGCATTGGTGAAACAGCGTGGCTTTGTCCAAAGGGACGTTCAAAATTCCATCAGCGCCGTGTTGTGTCCGCCATTCCTA